TheRedArchive

~ archived since 2018 ~

copralalic Archive

View 9 posts and 743 comments by copralalic on TheRedPill subreddit and various other subreddits related to The Red Pill community.
Search in:
In subreddits:
More
Filter by year/month:
Upvotes Comment on Subreddit Date (UTC)
5

For God's sake, please spell out your words. Textspeak makes you sound like an idiot. You have a real problem here; don't aggravate it by spelling like a 5-year-old.
/r/TheRedPill29/06/15 01:34 AM
2

I am sure there are going to be more than a few men gaming the system and getting "married" as a form of tax / legal protection. Marrying a buddy: the ultimate protection from common-law marriage.
/r/TheRedPill29/06/15 01:28 AM
1

True, crazy people are bad to partner with. Hopefully you kept both eyes open ahead of time and had a nice, long engagement so that her innner crazy could bubble to the surface. If not, well, you put yourself in a bad situation, which there's no point regretting, but you'll learn your lesson for next time. Been there, done that, wish I hadn't.
/r/TheRedPill26/06/15 12:32 AM
2

As Beige Phillip says, "It's always the man's fault." You "let your bitch get outta-pocket". That translates into: you let her emotions run out of her (or your) control. You failed some number of tests and she decided to settle for cash and prizes. If a marriage ends, it really is your fault because you didn't understand her nature and allow for it. If flawed men marry their mothers (seek undying devotion and dedication) then flawed women marry their fathers (seek a strong sense of guidance to t…
/r/TheRedPill24/06/15 10:54 PM
4

Plus, the way I look at it, it is kind of back pay, and make up pay, as much as we have to put up with y'all, No, no woman ever has to put up with me. Seriously, this kind of thing is enough to make MGTOW sound reasonable.
/r/TheRedPill24/06/15 10:23 PM
115

The brunette who ... is eternally grateful They never stay grateful, if they are ever grateful at all. As you said, they are all entitled. If I could find a 7/10 who was actually grateful and loyal and a real ride-or-die-bitch (in the words of Beige Phillip) I would build a bridge from the corpses of 8's, 9's and 10's just to reach her. Okay, a bit of hyperbole there, but, still. I would, metaphorically speaking.
/r/TheRedPill16/06/15 02:34 AM
1

Alpha can be defined by men. In fact in traditional monarchies the Alpha male is in fact the king. What alpha is, not who alpha is. If you are not alpha, you are not wanting to become alpha. You need to change your behaviors to become alpha, and it is women who interpret those behaviors. Look, it's simple: a lot of motherfuckers 'round here are sucking each others' dicks saying this is alpha and that is beta... who gives a squirt? Unto thine own self be true, and the rest of the world can fuck t…
/r/TheRedPill03/06/15 09:31 PM
1

Don't "want" to be an alpha male. Several reasons: 1) only women can decide what "alpha" is, and it varies by woman and situation 2) alphas are not substantially happier than betas -- they just get more pussy, which is not the same thing 3) there are lots of millionaire betas, and lots of convict alphas, and the betas would NOT change places with the alphas fucking ever. Ever. The pursuit of alpha-ness is like the pursuit of happy-ness -- if you weren't born into it then chances are you'll never…
/r/TheRedPill03/06/15 03:16 AM
3

Note the /s tag, it's short for /sarcasm. Which means, end of a sarcastic comment. So he knows, he was telling a joke.
/r/TheRedPill02/06/15 06:56 PM
1

No, I miss my wife. But I was also unhappy while she dead bedroom'd and cucked me. Am I happier? Maybe. I'll get happier in the future I'm fairly certain.
/r/TheRedPill02/06/15 06:45 PM
1

all you need to do is respect your partner, BP thoughts believe there are many other factors to compatibility as well, such as similar life goals, similar accomplishments, similar belief systems, good financial conditions, etc. A motorcycle chick and a Dungeons and Dragons nerd (to be extreme) would need to do a lot more than "respect" each other to stay together -- even BP would concede that. Leaving aside any reductio ad absurdum, BP also emphasizes "honesty" and "communication". while TRP say…
/r/TheRedPill02/06/15 06:41 PM
3

Beige Phillip rules: A woman is a reflection of the man she's fucking. Women have integrity amnesia. That relates to this post in that your frame can change who she is in the moment (reflection), and that her mind can change with the ethereal ebbs and flows of emotion (integrity amnesia). Also, don't be mad at fish for swimmin'. http://beigephillip.com/
/r/TheRedPill02/06/15 06:35 PM
1

they would quickly be deleted because they are not congruent with the inertial paradigm of conventional science. Sounds like you have a hypothesis. Go test it. When it gets removed, politely ask why. Good experiment... report back later.
/r/TheRedPill31/05/15 02:28 AM
5

It is annoying because you keep thinking these things are absolute declarations whole and entire unto themselves. It's not "all" that is required. Holy shit, you are annoying with your black/white -- the world is mostly gray, man. Scientists know that.
/r/TheRedPill31/05/15 02:27 AM
1

The most definitive statement in her weasel-blurb above is that one, which she is attempting to demolish. Straw man. Her own claims are far more subjective. You are going to have to learn to read more critically if you want to criticize science.
/r/TheRedPill31/05/15 02:23 AM
2

The number of weasel words in that snippet is impressive. She's not wrong, she's just... fudging. Notice the subjective voice and inexpert analogies... a proper philosopher would leave her sobbing in her hands with despair.
/r/TheRedPill31/05/15 02:21 AM
1

It's not so much a cult as it is a systemic way of approaching the unknown. It is a flawed system, indeed, but if you know of a better one they would very much like to hear it.
/r/TheRedPill31/05/15 02:19 AM
3

You are operating under the delusion that scientists think that they know what is going on... they don't. If scientists knew everything, they could just close their labs and go write poetry about their own dicks or something. They aren't even close. Do some argue passionately for their pet hypotheses? Absolutely. Is academia rife with political correctness? Definitely. Are the social scientists products of their environment? Without doubt. Does that mean that they are wrong and TRP is right? No.…
/r/TheRedPill31/05/15 02:17 AM
1

False dualism. You need to study philosophy before you study science. (That's what the "Ph" in "PhD" stands for, BTW.) http://en.wikipedia.org/wiki/Dualism
/r/TheRedPill31/05/15 02:13 AM
1

I Google-translated it. It was in there, towards the end.
/r/TheRedPill22/05/15 11:38 PM
21

The fine was for showing the video of her giving him oral to his friends. If he hadn't shown it around, he wouldn't owe her anything. She is, of course, not being charged for making a false allegation.
/r/TheRedPill21/05/15 12:03 AM
2

I think the key is to get a little starter-cut or hole in the garment in question. Also, remember that they cover both limbs. With panties I imagine it's better to just rip a hole in them and fuck her through the hole. Rip a big hole, though, so they are definitely not in the way. I've seen yoga pants ripped open in porn videos, but yoga pants are pretty expensive so I don't recommend those... tights or pantyhose maybe.
/r/TheRedPill20/05/15 11:47 PM
8

This time I didn't say a word, I just slipped my hand in her pants. She asked me what I was doing. I respond firmly, this is mine and I'll do what I want with it. She's telling her envious friends about that, guaranteed. A nice trick for later: get a t-shirt you don't care about anymore. Put it on her (don't explain). Start to fuck her. When she's getting close to climax, grab the shirt by the collar and rip it off of her body. You might want to cut the collar ahead of time to make it easier; if…
/r/TheRedPill20/05/15 04:57 PM
1

Funny that you mention Elizabeth I as an example of a leader... there are those who contend that she was in fact a man. http://www.historicmysteries.com/queen-elizabeth-man/ Even she said of herself that she had the heart of a man.
/r/TheRedPill20/05/15 01:41 PM
2

I think the emotion I feel that most closely describes how I feel about Hypergamy would probably be 'Disappointment'. http://en.wikipedia.org/wiki/K%C3%BCbler-Ross_model I decided I wouldn't use their insecurities against them, I wouldn't game them. I'd just be myself and try to be open and honest. I would expect the right girl to be above the pettiness. She'd see that life is finite and recognize the inherent value of someone that respected her. Fish don't fly, they swim. If you're looking for …
/r/TheRedPill11/05/15 08:38 PM
1

Hmm, I'm intrigued. Sounds like a challenge.
/r/TheRedPill11/05/15 08:22 PM
0

Sidebar. This shit is basic, man.
/r/TheRedPill11/05/15 07:40 PM
7

If you are not involved, and you want to video it for some reason, be discreet. If you call the cops, you can be overt if you like, but don't get physically anywhere near those involved. That's my $.02
/r/TheRedPill11/05/15 07:39 PM
0

He caused this situation, or at least, his involvement in it.
/r/TheRedPill11/05/15 05:24 PM
4

His choice to film it in an obvious manner is what created the situation. If he had stopped filming when the girl started yelling there would have been no situation to escalate. His own actions precipitated their reaction; if he had been subtle or just stayed uninvolved it would have just been one more fucked up thing you see living in a city.
/r/TheRedPill11/05/15 05:23 PM
2

There were a lot of witnesses in this particular case, plus Davidkpa had a woman there to testify on his behalf, so the two women basically cancel out. Two chicks telling different stories, gotta go with the physical evidence, which was blood and bruises on him but not a mark on her.
/r/TheRedPill11/05/15 05:20 PM
5

If you read the comments, the woman with the gun is apparently a corrections officer or court officer or something, and she didn't identify herself. Apparently she pistol-whipped the black girl right at the beginning, and the black guy jumped in after that. It seems there was also an investigation into why and what went wrong. I think the amount of restraint shown, considering that she was a trained officer, was probably appropriate, but if it were a civilian she could have shot that guy in a co…
/r/TheRedPill11/05/15 05:15 PM
9

I concur with all of the above, and if you decide to video it, fucking be inconspicuous. Source: used to work private security, where we were armed but our instructions were that the telephone was our most reliable weapon.
/r/TheRedPill11/05/15 04:49 PM
2

"Not caring" about acting beta isn't Red Pill and doesn't make you alpha. I disagree. I think it's the endpoint of Red Pill. I don't care about acting alpha, I only care about my own sincerity and being a decent human being. "Alpha" and "beta" are truly decided by women; men didn't make up those categories. So long as you view your actions through that lens, in a way you are letting women determine how you behave. RP =/= alpha, and that's a very common misconception around here.
/r/TheRedPill11/05/15 04:22 PM
1

I enjoy thinking. It is absolutely my favorite thing to do, without any close second. I think about "super-pests" multiplying in weeded lots, I think about the construction next to my place, I think about my job, I think about Earth-destroying asteroids and inventions to stop them, I think about the people I meet, I think about clean energy, I think about the food I eat, I think about Red Pill, I think about my job and my education, I think about my interactions with others; I think about absolu…
/r/TheRedPill11/05/15 04:16 PM
0

Then u should have gone home Drink. Drive. Duh. If I was there, I'd be making amok. I mean it when I say it: if she can do better than me, then she should do better than me. If you're better than me, she should definitely fuck you, and I wish her well. I'm going to live my life the way I want, and if others call that "beta", well, that doesn't matter to me even as much as one squirt of fetid rat piss. Real Red Pill is living life your way.
/r/TheRedPill11/05/15 09:58 AM
0

I'm not her "Chad". And if she wanted to threesome them, she could, it's not my business. And these guys are not the type you -- or a lot of men around here -- claim to be. I think the false bravado a lot of men are showing in response to this FR shows more insecurity than anything I've said.
/r/TheRedPill11/05/15 09:54 AM
4

In what world does one partner cheating on another equate to fish swimming? Hypergamy. They are great people and valued friends but I would never date them and certainly never have sex with either of them. See, no virtue but still human, even nice and fun. Good people, good vaccination against madonna/whore misogyny. But I did want to point this out. If you're going to take the position that cheating is somehow "normal" behavior (fish analogy) that should be happily accepted Im just going to hav…
/r/TheRedPill11/05/15 09:40 AM
12

Don't be mad at fish for swimming. It's what fish do. It takes too much energy to be angry, you just at some point realize that you can let it go any time and be free. There is a lot of pain there, but when you get to the point where you can accept things as they are, then the pain goes away. You have to forgive yourself for not knowing what you didn't know, and move forward. It's a long, slow process, but the anger recedes eventually. It might help you to make friends with a prostitute. No, rea…
/r/TheRedPill11/05/15 03:25 AM
1

Why would it be awkward? They are just guys who know her, no big deal. And why would sleeping viewed as weakness? It came from a place of DGAF. Mate guarding is beta and can also be viewed as weakness, it's just how you do it that matters. I did exactly what made me happy, which is all any of us should ever do.
/r/TheRedPill11/05/15 03:15 AM
4

OP is a teenager, parents are still a long way from dying. Mom has plenty of time to run her finances into the gutter.
/r/TheRedPill11/05/15 03:09 AM
1

Most shit tests are safely ignored. One of them was as follows: The plan the next day was Mexican food. She started going on about how good a grilled cheese sounded. I told her she could go buy her cheese for grilled cheese and I'd get my Mexican food. No need to coerce or force or remind her of the plan; I'm going to do what I like and she can tag along or do her own thing, I'm unaffected. That's a minor thing, but it's so recognizable because of its relation to the whole "where do you want to …
/r/TheRedPill10/05/15 08:27 PM
-1

I was polite, which is something I do for me because I'm a decent human being, and when I was tired I excused myself. I was ready to sleep; I didn't go to sleep for any other reason than that. I've found that I can hang out with pretty much anyone, because I'm naturally a fun guy to hang out with, and people just let me take over so that everyone has a good time. If I wanted to hang out, I would have. She asked me to, but I preferred sleep.
/r/TheRedPill10/05/15 08:22 PM
5

I could point out particulars -- he would have been far more likely to meet her at an archery competition rather than a bar, for instance -- but it would not change your perspective. I am above-average looking, which has always been plenty in my mind. Obsession with one's appearance is fretting over how many angels can dance on the head of a pin. It's moot unless you are willing to do something about it (e.g. plastic surgery).
/r/TheRedPill10/05/15 08:14 PM
3

all that theory and analysis and when it comes down to it they most likely did not give two shits about the girl and were just glad for a place to stay. Very true, they were probably just glad for a place to stay. But they are both single and do not have a lot of options, so it is reasonable to presume that if they had the opportunity, they would act on it. also you do beta things because you are, I don't claim to be alpha, beta or any other particular symbol from obscure European alphabets. I d…
/r/TheRedPill10/05/15 08:11 PM
5

You can do a lot of stuff wrong and it still come out right, if you know what you are doing.
/r/TheRedPill10/05/15 06:39 PM
1

Late night hang outs with males friends, associating with dudes you've been with, grinding on dudes at the club, super sensual dancing, etc. is a big no no. Doesn't matter if it's not a LTR.
/r/TheRedPill10/05/15 06:37 PM
0

LTRs are just trouble, they are more likely to fail than not. Think about it: if the ultimate culmination of a relationship is lifelong companionship and love, even marriages are 50-50 for not ending, let alone whether there is love there or not. Then take into account all the LTRs that don't even make it to marriage. LTRs are a fool's game. Relationships have an intrinsic time limit, honor that and enjoy what you have while you have it. Paradoxically, that might make it last longer.
/r/TheRedPill10/05/15 06:27 PM
0

I spent enough time with them to be polite, then went to sleep. They stayed up to play on her video game console, which I have never been very much into.
/r/TheRedPill10/05/15 06:20 PM
1

A lot of men who show up here are pretty thirsty. Little do they know that lack of sex is the symptom, not the disease. Like the Kaposi's Sarcoma of AIDS, it is their BP ways that are rotting them from within. Of course they want a cure for the sarcoma, but they need a cure for the AIDS.
/r/TheRedPill10/05/15 06:10 PM
2

I got there later. I am sorry that the UN failed you so badly.
/r/TheRedPill10/05/15 04:48 PM
1

Not a fucking FR. Learn to flair.
/r/TheRedPill10/05/15 02:37 PM
2

Lots of hot Muslim girls in Bosnia. Source: carried a machine gun there to make sure other assholes with machine guns didn't machine gun them down.
/r/TheRedPill10/05/15 02:32 PM
0

Marry a nice Muslim girl in India or Malaysia, plenty of good economic opportunities over there.
/r/TheRedPill10/05/15 02:29 PM
3

His expenses are nothing if all he does is press releases.
/r/TheRedPill08/05/15 08:06 PM
15

Intervening in domestic violence, even cops will tell you, can end up with both of the other parties attacking you. And if you cause any physical harm, welcome to a lawsuit, where the woman will say whatever she wants if she thinks she can get what she wants, i.e., a payday. There was a CSI Miami plotline about exactly that.
/r/TheRedPill08/05/15 03:48 PM
12

I think a publicity-hungry lawyer would take it just for the newsprint.
/r/TheRedPill08/05/15 03:45 PM
5

It's a callback to your mother. Sounds like Freud shit, but it is. Your woman is not and can never be like your mother. You can't be a fifth grader again, and you can't have your mommy again, no matter how much you want either. It's a lie you tell yourself to feel better. If you can't picture in your mind Clint Eastwood doing it, don't fucking do it.
/r/TheRedPill08/05/15 02:43 AM
3

She's just a plate to you, there are plenty more. If he's gonna be a bitch and she lets him, it's not worth the drama, move on. Abundance.
/r/TheRedPill08/05/15 02:35 AM
1

ex-cons get no benefit of the doubt
/r/TheRedPill06/05/15 10:43 PM
2

Women do powertalk... addressing anything overtly proves that you don't know how women communicate and are therefore an inferior male.
/r/TheRedPill05/05/15 09:59 PM
2

BJs also would not have counted to the hamster... but married women are renowned for not sucking dick. They'll suck Chad's dick, sure; but they are still more hesitant and out of practice than they were when they were co-eds.
/r/TheRedPill05/05/15 09:57 PM
2

This. It would be nice to learn how to wire a thermostat, which is a useable skill, and also to fuck with a fuckwad. Bravo!
/r/TheRedPill05/05/15 09:52 PM
3

I think you mean fun-gible!
/r/TheRedPill05/05/15 09:49 PM
42

He is getting a harsher sentence because he did 8 years for cocaine charges. Drug laws are bullshit, but still, ex-cons get no benefit of the doubt.
/r/TheRedPill05/05/15 09:48 PM
10

Dating is a zero sum game. If he gets the hottest chick, I don't. Maybe that night. Remember, though; she's not your girl, it's just your turn.
/r/TheRedPill04/05/15 11:20 PM
1

No citations, huh? Thought so.
/r/TheRedPill04/05/15 11:18 PM
1

How the fuck did you leave Beige Phillip off of there? And Black Phillip, though you can only get it on YouTube and not in podcast format.
/r/TheRedPill04/05/15 09:12 PM
1

If women are the only achievement you have in mind, your goals are too narrow. I plan to build an empire. Warren Buffet (not my industry, but I can admire the fucker) is not sitting around wondering what to do with his time. Retirement is for quitters. I have nieces and nephews that I love and that I can watch grow up. Sure, they're not mine, but I still love them and enjoy them.
/r/TheRedPill04/05/15 09:04 PM
1

Hand-waving. If there is so much out there, then you should find it easily. Either put up or shut up -- you are the one who claimed "science". Here's a headstart: http://scholar.google.com/ EDIT: oh, fuck. I guess "science" just proved you wrong... hawt dudes in McDonald's work outfits do worse than chubby dudes in rich suits. I guess in your language, "science" just means whatever you think is right, not what has actually been, you know, shown in hypothesis driven research. Hmm. Crazy. http://w…
/r/TheRedPill04/05/15 08:41 PM
1

On Beige Phillip they say redhead men are attractive in Columbia... or Ecuador. One of those.
/r/TheRedPill04/05/15 02:25 AM
3

If you claim science, you have to cite sources. Otherwise it's bullshit.
/r/TheRedPill04/05/15 02:24 AM
3

I know a shit-ton of physicians. I don't want most of them. Your point is otherwise sound, however.
/r/TheRedPill01/05/15 09:36 PM
4

Not all 30+ women are like that! At least, that's what I hear. And it's usually women saying it. (Callback to an earlier, excellent post last week.)
/r/TheRedPill01/05/15 09:35 PM
1

Definitely, but I learned a shit-ton in one night, more than my successes have recently taught me.
/r/TheRedPill01/05/15 09:34 PM
1

I will do that in the future, but as it turns out, the experience was very useful.
/r/TheRedPill01/05/15 09:31 PM
11

As OP, it is my right to declare: this comment wins the thread.
/r/TheRedPill01/05/15 09:29 PM
5

It sucks hard to actually do it, though. But you will grow.
/r/TheRedPill01/05/15 09:29 PM
1

I definitely could have done better, but that's the point of challenging yourself, is to grow.
/r/TheRedPill01/05/15 09:28 PM
4

the men they want are fucking their daughters Yeah, turns out by coincidence I was hitting on her niece the other day. Awkward moment when she told me that. Really awkward.
/r/TheRedPill01/05/15 09:27 PM
1

Yeah, the M-60 is slow, but it's not a ma-deuce, or a mark-19. Still, it sucked.
/r/TheRedPill01/05/15 09:26 PM
12

That was exactly what she was doing, trying to get a rise out of me. She finally succeeded.
/r/TheRedPill01/05/15 02:53 AM
28

Like I said, I wanted to fuck her. Then I got to know her.
/r/TheRedPill01/05/15 02:51 AM
1

Those triple figure guys are the exception, far and away. We talk in majorities here, not in exceptions, so that we can escalate the dialogue. Not all women are actually like that, but statistically speaking the minority that are not like that are so infrequent as to be less than noise in the data, and any positives are overwhelmingly likely to be false positives. Same with pussy-slaying nerds... it just doesn't happen that much outside a few certain small circles.
/r/TheRedPill01/05/15 02:41 AM
0

You can trust what he says about bowel movements.
/r/TheRedPill29/04/15 06:13 PM
11

Here's my help: don't write n00b. It's childish, and we are men.
/r/TheRedPill28/04/15 11:43 PM
2

People in the ad business are even more shallow and deceptive than actors. Not all, obviously, but that's what makes you good at it. Source: pulled that right out of my ass. No source at all.
/r/TheRedPill28/04/15 11:34 PM
1

Shakespeare knew that Evil will always triumph, because Good is dumb. https://www.youtube.com/watch?v=ZLElEqzJArI (quote is at 3:05, but watch the whole clip)
/r/TheRedPill28/04/15 11:15 PM
4

I do the dishes because I fucking want clean dishes It's not the "what", it's the "why". It's always the why that matters. If you're doing them because you want to, then it's a good thing. If you're doing them because she browbeat or whined you into doing it, it's a bad thing. Studies have shown that marriages with even split or more housework done by the male have a higher divorce rate. I don't think it's the housework, though; I think it's the "why" of the housework.
/r/TheRedPill28/04/15 11:09 PM
15

The way you phrased this is awkward and hard to follow. Sorry, just thought I would let you know.
/r/TheRedPill28/04/15 12:52 AM
1

Holy fuck, mostmodest has a thing for grandma's cookies! That's okay, I'd still fuck Susan Sarandon from her SNL skit. https://www.youtube.com/watch?v=X0DeIqJm4vM
/r/TheRedPill28/04/15 12:37 AM
0

Vibrators can extend things for quite a while. Have to be careful, though -- the female can become desensitized.
/r/TheRedPill28/04/15 12:35 AM
2

Yeah, you're not immune, though -- just protected. That's why they call it hard mode!
/r/TheRedPill28/04/15 12:33 AM
2

Sallies compete, that's the difference.
/r/TheRedPill28/04/15 12:29 AM
7

Women and white knights do not know gratitude.
/r/TheRedPill28/04/15 12:27 AM
7

Nope. Nope nope nope. Dave will use it against him. Dave is already running shit behind scoundrel's back -- bet money on it. Redpill is toxic enough that it just cannot be discussed. The best you can do, the very best, is refer them to the No More Mr. Nice Guy book, and that's really plenty. RP flows from that book, if you let it change your life. You CANNOT FUCKING TELL ANYONE ABOUT REDPILL. Oh, you can try... it just doesn't fucking work. Ever. Fucking ever.
/r/TheRedPill27/04/15 10:12 PM
29

Cut your ties, or prepare for some Iago shit. (No, to those of you who don't read literature, I don't mean the fucking parrot.)
/r/TheRedPill27/04/15 10:09 PM
17

4) Your safest bet is to marry a woman who believes her own SMV is lower than yours, not a woman who YOU believe to be lower in SMV than you. I would say it would be better to marry an equal and then increase your SMV and/or let hers fall a bit.
/r/TheRedPill27/04/15 10:03 PM
11

I also live in a city, and there are a lot of Chads, but there are also a lot of Sally Semen-Swallows, so it off-sets. No, lower SMV women will not be "grateful". It's not in their nature. If you want to dread by SMV you have to start out equal and then increase your SMV (or wait for hers to decrease). Then you can get dread, because women understand that men stay for loyalty... but only for so long. Don't start out with a lower SMV woman; it just doesn't work.
/r/TheRedPill27/04/15 10:01 PM
34

Yes. LTR'ed. She immediately started acting the bitch the minute she had my commitment. Fuck near broke up with her, she talked me out of that, so she was downgraded to plate when I revoked my commitment. Lower SMV women are not worth it. If you're going to handle all the shit of an LTR, might as well be fucking a hottie.
/r/TheRedPill27/04/15 09:58 PM
8

If you generate quality content and comments, over time you may become endorsed. It's kind of random, actually -- you just have to get noticed for regularly producing quality content. I am not endorsed because I haven't earned it, same with 98% of non-endorsed guys.
/r/TheRedPill27/04/15 09:48 PM
2

Guys who either don't have the ability or the motivation to be top 20% go MGTOW.
/r/TheRedPill27/04/15 09:45 PM
2

Also, women on deployment, don't get me started Fucking whores or spoiled brats, or most often, both.
/r/TheRedPill27/04/15 12:45 AM
1

That was fucking depressing. The last minute I truly felt bad for almost all of those women. I feel especially bad for the one with the flowers in her hair and the huge breasts, because she's the real victim of feminism. She just wants to be a mom and have a home and a good husband, but she's been fucked out of all that because oppression. Poor girl, she's probably pretty awesome in real life, and I hope some lucky Polish dude nails her down and nails her good.
/r/TheRedPill27/04/15 12:30 AM
2

She's probably "grateful for the scraps" type.
/r/TheRedPill26/04/15 11:56 PM
10

Beige Phillip: lay the five bricks. "Open" five women a day (could be the produce girl at the supermarket, doesn't matter), just open five different women every day, that's 35 a week, that's 150+ in a month, that's 1,000 in 6 months. At the end of the year you have a whole brick wall, and the bricks at the top are better than the ones at the bottom, because you learned how to lay bricks better as you went along. If you do the work, it won't take you 6 months... in 4 weeks you will be good at ope…
/r/TheRedPill26/04/15 11:49 PM
1

Is it accomplishment, though? I would say, maybe not, but then again, many young men don't do anything more with their lives than that.
/r/TheRedPill26/04/15 11:04 PM
1

Women are getting more college degrees, so if you consider that an accomplishment, then they are achieving. I think that less attractive women are working harder than ever, and harder than they want to, but they don't really realize it.
/r/TheRedPill26/04/15 02:58 PM
3

Not a good plan. Never works.
/r/TheRedPill26/04/15 02:55 PM
3

If a good-looking man is with an ugly woman, he probably has self-esteem issues and people assume the worst about him.
/r/TheRedPill26/04/15 02:54 PM
6

That's because he's the epitome of an unthreatening male. He inspires no strong feelings at all.
/r/TheRedPill26/04/15 02:46 PM
1

I think you are able to punch above your weight, i.e. attract women you aren't really ready for. If you want my advice, for whatever free advice from a stranger is worth, you need to practice on ugly chicks. It is so easy for me to hit on women who don't look quite right or appealing to me. I can own them with flirtation, teasing, SFW kino, etc. The minute I try spitting game at women I perceive to be quality I change. Today, for example, I was talking to a sexy oral surgeon, and while I was my …
/r/TheRedPill24/04/15 10:30 PM
9

The problem is your certainty.
/r/TheRedPill23/04/15 12:57 AM
1

Being a doctor sucks with the student loan burden. Source: I know a shit-ton of young doctors and medical students.
/r/TheRedPill22/04/15 11:56 PM
4

He says as much, he just says that raw physical attractiveness is a pre-requisite for getting laid in a non-provider fashion. I'm not sure he's correct, since a lot of women today will fuck a dude for the story, but if you're talking about "tingles at first sight", yeah, he's got a point.
/r/TheRedPill22/04/15 11:54 PM
5

"... hard work trumps talent until talent works hard." He wrote this right there in the post. If you work hard on your swagger, your posture, your abundance mentality, etc. you would be whooping ass on the little guys. All you have right now are excuses. Oneitis is really just lying to yourself, you know.
/r/TheRedPill22/04/15 11:52 PM
4

Do you think she was honest and forthright about it, though? Was her approach to this issue respectful of his feelings and their past relationship? Or was this little-girl-acting-out bullshit, hopping from one lilypad to the next only when she saw precisely where it was? Of those two choices which is closer to the story he related?
/r/TheRedPill22/04/15 11:39 PM
14

You know, I never got that Cracker Jack box that had the fucking TELEPATHY RING that apparently you did find. If you think you know what another person is thinking that is either 1) delusion or 2) projection. You are either insane or a grade-A narcissist. So, have fun with that.
/r/TheRedPill22/04/15 11:36 PM
6

If you think you have never been fooled, and can never be fooled, well... you're asking to be fooled. What you don't know won't hurt you, of course, until it does, or it doesn't, whatever. It doesn't matter. The point is this: people with excess hubris (you) are inevitably surprised when the "impossible" actually occurs. Best to you.
/r/TheRedPill22/04/15 11:34 PM
2

On Beige Phillip, Dante talks about a girl "needing a little time". He says, "Fine, you can have it all. Have all the time. Forever."
/r/TheRedPill21/04/15 02:12 AM
6

You already know what she's like. Act accordingly. The best looking woman you've ever been with has a lot of power over you... almost a guy version of Alpha Widow. Sometimes the fire is too hot to touch, all I'm saying.
/r/TheRedPill21/04/15 02:08 AM
1

If are a dating a "concubine class" girl this is when it should come to an end. But if it is a quality woman (not a unicorn, since those don't exist) it can take multiple months for her to even open up to you fully. Not that it is necessarily even worth it then, just that it sometimes takes that long.
/r/TheRedPill21/04/15 02:02 AM
14

No. Women always think that they were good enough to get you. That's how they get alpha widowed, and why they think they are settling for BB hubbies. If they got a 9 guy one time, she thinks she is a 9 as well, despite the fact that only a schlub 6.5 BB would want to commit to her. Women are not rational about this shit, they can't be instructed, informed or negotiated with. The facts they believe are the facts they want to believe, so you don't have to accept their reality except to accept that…
/r/TheRedPill21/04/15 01:52 AM
5

This is relatively minor to the really shitty shit that can happen in a marriage. This is small potatoes, really.
/r/TheRedPill21/04/15 01:47 AM
13

She does love him, but... That's the bitch of it, the women really do love their beta providers. They want to cuddle on the couch and watch Netflix, and go on family picnics and trade funny greeting cards on their anniversaries. They really, honestly do love their BB husbands. They just don't want to fuck them.
/r/TheRedPill21/04/15 01:46 AM
1

Whenever a woman tells you how many men she's slept with, assume that the actual number is at least double what she tells you. Unless the number is zero or one, in which case, add at least five.
/r/TheRedPill21/04/15 01:44 AM
3

The smart plan would be to offer these injections free of charge Currently abortions are subsidized for low-income women; I'm sure the same philanthropists would subsidize vasalgel for low-income men.
/r/TheRedPill21/04/15 01:33 AM
2

That's not what he said. He didn't say men were more fit for rustic life, but he implied that males are more inclined to be favorably disposed to rustic life. Rule #1 of debate: argue what you want to argue and not what the other person actually said. You followed rule #1, but you got caught, so please try again or admit that you were incorrect.
/r/TheRedPill19/04/15 09:48 PM
2

Women have more to offer men than sex. It's just that the really good stuff, the for-lack-of-a-better-term joie de vivre, is an intangible that is individualized and highly subjective. No (sane) man or woman would ever argue that a good man can not enrich a woman's life, but the reverse is also true. Women make us better in ways that are hard to quantify but easy to see. The problem is when those improvements alter our basic masculinity -- then it's everyone's problem and ain't nobody happy no m…
/r/TheRedPill19/04/15 09:41 PM
3

Very few women appreciate being compared unfavorably to a puppy. Very true. Beige Phillip has basically said that they get a lot of mail every time they compare women to dogs. It seems that the poor pups get highly offended when they're told that they're no better than a bunch of whiny, entitled, narcissistic human twats.
/r/TheRedPill19/04/15 09:36 PM
1

My mistake, I thought vasalgel was the same thing as RISUG or whatever that Indian stuff was, my bad. Vasalgel is not proven.
/r/TheRedPill19/04/15 09:32 PM
2

I don't care for manual labor as a job, but if it's for me (my tent, my fire, my breakfast) I really enjoy the hell out of it.
/r/TheRedPill19/04/15 09:27 PM
1

Correct. I do not know one. Not. Even. One.
/r/TheRedPill19/04/15 09:26 PM
1

maybe build a small community with my closest friends and shit who would travel all the way across the earth if I was bleeding out in some other country (which unsurprisingly my female "closest friends" would never do lol).. A man can dream My community would be in the Rockies, not the Urals, but, yeah, same idea. A man can dream.
/r/TheRedPill19/04/15 09:25 PM
5

It's not like they necessarily wake up and decide to make everyone else's day hell... they are just that way. You know it's not a choice because they are (almost) all that same way. Raised in a similar economic class and culture, the results are largely the same -- middle-class white teenage girls are the most obnoxious people on Earth.
/r/TheRedPill19/04/15 09:21 PM
14

They will oppose it if it opposes them (their power). They really don't care what happens to womenkind, just the women (and men) who give them power. If it helps them, great, if it doesn't, DIE IN A FIRE YOU SEXIST IMPERIALIST PALE-PENIS PIGS.
/r/TheRedPill19/04/15 08:27 PM
1

Perhaps condoms + vasectomies are more effective, but condoms alone are not more effective than vasalgel.
/r/TheRedPill19/04/15 08:25 PM
8

A consequence you didn't mention: abortion. If a single vasalgel is cheaper than a single abortion... What will happen to U.S. politics when abortion becomes essentially moot? EDIT: and OMG, what about poor Maury?!? What will a washed-up news presenter do NOW???
/r/TheRedPill19/04/15 08:21 PM
14

Although I understand where you're coming from in general, in this particular case that is not the case. As always, it is helpful to ask cui bono from the long delay in FDA approval of vasalgel, and the answer has been urologists. A vasectomy is an in-office procedure that costs a couple hundred dollars, but a vasectomy reversal is an operation that costs tens of thousands. Across the country that amount of money adds up quickly and the few hundred thousands it takes to influence the right peopl…
/r/TheRedPill19/04/15 08:21 PM
10

However, any guy who never lived that lifestyle to the extent your sister has is likely going to reject her if she has had a lot of partners, casual sex, etc.. Nope, plenty of thirst betas out there who think the past doesn't matter...
/r/TheRedPill19/04/15 08:10 PM
7

Yeah, you're screwed. Sorry pops. Hopefully you have at least one other kid.
/r/TheRedPill19/04/15 08:10 PM
3

Be careful of even restraining her, it can look like aggression. I like the laughing at her part, but it's not funny if that makes her grab a kitchen knife... hmm. This is a tough one, bears some careful thought.
/r/TheRedPill19/04/15 08:01 PM
16

This was my brother's tactic. He pulled it off in 3rd grade. Unintended consequence: all future punishments came from dad. Ouch.
/r/TheRedPill19/04/15 07:58 PM
4

they're fat, so fuck them I imagine this might be a good tattoo. On second thought, nevermind, it gives the impression of being a chubby chaser. Still gave me a good laugh, though.
/r/TheRedPill19/04/15 07:56 PM
1

You sound like you know, just keep warning any other westerners that set foot in that shark's paradise...
/r/TheRedPill19/04/15 07:47 PM
1

If you she loves you, she'll do anything. Give her the party, the ring and the dress, but don't sign the papers. Also, make sure it's not a common law state. She can have everything but the marriage license. Bonnie shot cops for Clyde; a woman who loves you enough will forgo a piece of paper.
/r/TheRedPill19/04/15 05:11 PM
1

So how many well off Westerners actually want to live in Ukraine? If I had a job I could do over the Internet and earn what I did as a programmer (~$40K), then living abroad would be very attractive. The thing is even if you learn the language you never really learn the culture. Corruption/legal system being the primary example from my trip to Kiev (taxi driver handled it for me, though).
/r/TheRedPill19/04/15 05:08 PM
2

EE bitches will eat you up like Grape-Nuts, son. I've fucking seen it happen. If they are not insane crazy in love with you they will sell your fucking kidneys for parking money. AEEWALT.
/r/TheRedPill19/04/15 05:04 PM
4

Haven't most of us newer users been led here by anti-TRP vitriol? Referred by a link that asked how cavemen had figured out the Internet.
/r/TheRedPill19/04/15 05:03 PM
1

Good reason to not look for marriage.
/r/TheRedPill19/04/15 04:43 PM
15

since no one will want to wife me after 25? Wow, you've been reading around here too much. Or not enough. The sexual value of a female diminishes somewhat after the age of 18, but the rate of the decrease accelerates after about 25. That doesn't mean the morning of your 26th birthday you will be a hag that men would rather throw rocks at than look at. You will still have the majority of your attractiveness for most of your life, especially if you take care of yourself by eating right and exercis…
/r/TheRedPill19/04/15 04:14 PM
7

Awwwww shit. TRIGGERED. Now where's my recovery room with crayons and goldfish and panda-fart-scented candles?!?
/r/TheRedPill15/04/15 02:15 AM
4

I don't care that you don't care! Seriously, though, your writing reflects your thoughts. There is no benefit in antagonizing any particular group with boorish insults, it serves no reasonable purpose. I feel precisely the same way about other slurs, whether they are groups I sympathize with or groups I despise (see:Tumblr). We can all improve here. Needless provocation is needless.
/r/TheRedPill15/04/15 12:01 AM
1

Oppressed, fuckstick. Get your own terminology right.
/r/TheRedPill14/04/15 11:07 PM
0

The old tests, CVS and amniotic fluid testing, carried risk of spontaneous abortion. The serum tests do not.
/r/TheRedPill14/04/15 11:05 PM
0

It's expensive and you should only do it if you were testing the kid for something else anyways, say some family genetic illness. Otherwise, take a buccal swab (cheek + Q-tip) after the li'l bundle o' joy is in the world.
/r/TheRedPill14/04/15 11:04 PM
0

CVS is still dangerous, with a 1% chance of spontaneous abortion. Serum tests are harmless to the fetus.
/r/TheRedPill14/04/15 11:02 PM
2

This is true, they can test the baby's DNA from the mother's blood now. It's not cheap, though. Also, a lot easier if the baby is a boy.
/r/TheRedPill14/04/15 11:02 PM
3

Great post, thank you for clarifying. It also gave me a good chuckle, because they will essentially be turning back the clock, where our "modern" civilization would come to resemble older civilizations (particularly in the East and Middle East) where multiple marriages were/are acceptable... The irony, it tickles.
/r/TheRedPill14/04/15 10:57 PM
1

Good point. These weights are basically maximums, unless you are a pretty bulky lifter. Remember, though, that old lifters are basically pudges (Exhibit A: The Arnold). Even heavy lifters with lots of bulk should consider cutting down to below BMI 30. The three ways to assess your body mass are: BMI, body fat %, and waist size. Easiest - waist size. Over 40 inches? You are more likely to die and get metabolic diseases (heart disease, diabetes). If your waist is >50% of your height (e.g. 35 inch …
/r/TheRedPill14/04/15 10:49 PM
3

I don't care about numbers if she doesn't fit my archetype. Some men want variety of types -- they want to sample all kinds of alcohol -- and some want variety within a category -- want to sample every kind of beer. I'm the second type.
/r/TheRedPill14/04/15 10:39 PM
1

LTR is TRP hard-mode. Good luck. (You'll need it!)
/r/TheRedPill14/04/15 10:33 PM
7

That number of tats is a definite red flag.
/r/TheRedPill14/04/15 10:31 PM
1

Good, that was what I was hoping to see when I clicked the link.
/r/TheRedPill14/04/15 10:27 PM
11

Women support fag "marriage" not because they actually care about fags (the social status benefits of supporting gay causes are nice, but purely a side benefit), but because they're actually aiming for state-sanctioned polygamy (basically, they want social approval of 80/20, and it manifests itself as a desire for official sanction of polygamy) I don't care for the way you are using the word "fag", it seems uncultured. Now, on to your point. What do you believe the purpose of women espousing (pu…
/r/TheRedPill14/04/15 10:22 PM
8

Conservative factions of the LDS (Mormon) church still do this. HBO series "Big Love", TLC series "Sister Wives", watching the news about wacko compounds in Utah and Texas... it's a real thing. The ones in the compounds are creepy/scary. The ones on "Sister Wives" are typical hamplanet housewives, just he's got four of 'em. (One is in decent shape, the others are intimidated by her.)
/r/TheRedPill14/04/15 10:13 PM
7

I stopped fucking my girl for three weeks because I was pissed at her. We'd do the "her stuff", you know, kissing, fingers, cunnilingus, etc., but when it came time for penis-in-vagina I just wasn't in the mood. She just wasn't doing enough to keep me interested. This was also when she got demoted from LTR material to plate status. When she changed her MOTHERFUCKIN' attitude, she got the D. I hope the lesson is learned, because demotion from plate is nexting.
/r/TheRedPill14/04/15 10:04 PM
1

He pulled her into his frame because he stopped and faced her. If she had stopped him and faced him, then the equivalent would be to start walking away and let her catch up. It's the same you would do with a child. When you need to tell the child something important, you pull them out of play mode, look them in the face, and state what you have to say very clearly. Once you know that they understand, you move on.
/r/TheRedPill14/04/15 09:59 PM
4

Those are Black Phillip "bears". They just want to fight. Black Phillip "deer" are fishing for a compliment. The response is to tease them. Black Phillip "bunnies" wouldn't say it that directly, they would bring it up in a very general way. They are more prone to comfort tests than shit tests anyways.
/r/TheRedPill14/04/15 09:56 PM
4

Ending it over that simple question is a bit abrupt. I'd think you could give the relationship a bit more time and forgiveness than that.
/r/TheRedPill14/04/15 09:54 PM
0

It's rare, but it's real. In 2012, 64% of women murdered by a man were murdered by a romantic partner or spouse. That doesn't count ex-boyfriends because the FBI doesn't track that. I've seen it, but the friend of mine in the Army didn't bother using a gun. He beat her fucking brains out with his bare hands. You do not want to be anywhere near that kind of shit. https://www.vpc.org/studies/wmmw2014.pdf
/r/TheRedPill14/04/15 09:49 PM
1

Either it won't work, or it won't be anonymous after a while.
/r/TheRedPill14/04/15 09:44 PM
1

You can definitely say no, just say no like chicks say no. Like I said, feed their hamster and you're fine.
/r/TheRedPill14/04/15 09:43 PM
1

I didn't say that they were right-wing, just right-leaning. Supporting the 2nd Amendment is definitely, definitely right-leaning.
/r/TheRedPill14/04/15 09:42 PM
1

Which of those things can you change? If you were going to kill yourself anyways, what do you have to lose?
/r/TheRedPill14/04/15 01:34 AM
11

Makes me grateful my ex never wanted kids.
/r/TheRedPill14/04/15 01:31 AM
1

You can talk about PUA, especially if you can point out examples and demonstrate tactics immediately, but you should never discuss TRP without sensing where the guy is first.
/r/TheRedPill14/04/15 01:26 AM
-7

Fuck. No. Never. Don't do it. Ever. Not your place. It's fucked up, but too bad, most of life is. You don't want to be the one to get in the middle of that. If a guy's wife is stepping out, there is a VERY REAL chance he will blow her fucking brains out onto the walls, ceiling, windows and floor... and you don't want to be an extra in that particular horror show.
/r/TheRedPill14/04/15 01:18 AM
3

Yes... Immanuel Fucking Kant.
/r/TheRedPill13/04/15 11:52 PM
6

The ratio of psychopaths in all positions of power is higher, but there are more psychopath politicians than in most other walks of life.
/r/TheRedPill13/04/15 11:50 PM
9

Exactly. And a disproportionate number of politicians are psychopaths.
/r/TheRedPill13/04/15 08:49 PM
2

You didn't pull out of the crazy. (Unless she's reacting to your inconsistency, which women find even worse than BB. At least a BB is predictable...)
/r/TheRedPill13/04/15 08:48 PM
3

What actually motivates people is knowing their work has purpose and value That works so long as remuneration is roughly equivalent. I didn't quit my $50K job when I was 25 y.o. despite hating it precisely because I knew I couldn't replace that level of income. Did what I produced matter or have meaning? Fuck no. But the pay was awesome, so I kept at it until I got laid off. (Plural of anecdote is not data, but I've seen it with others as well.)
/r/TheRedPill13/04/15 08:36 PM
2

work together to improve society or fuck it all up It always works out for the 2nd of those two options. Commons go to shit, always, eventually.
/r/TheRedPill13/04/15 08:34 PM
9

Who gets to distribute the resources? Ah, the crux of all redistributionist schemes: who watches the redistributors?
/r/TheRedPill13/04/15 08:32 PM
3

You have no rights by default. Nope. Bullshit. Fuck your dumb ideas. (That's all I read, it was plenty.)
/r/TheRedPill13/04/15 08:30 PM
7

I think the emphasis on self-reliance is more compatible with what Republicans say they support (until it's time to vote against pork for their own districts). Most young, single men are more compatible with right-leaning politics, at least in the US.
/r/TheRedPill13/04/15 08:25 PM
1

By that logic, Muslim and African society is better than modern Western society "Better" is a value judgment. "Stable" is not. Muslim marriages are more stable than modern Western ones. Is that a good thing? Yes. Is a muslim marriage overall a good thing? I personally don't think so, but they do have a few concepts that I find useful.
/r/TheRedPill13/04/15 07:50 PM
1

I believe women will marry if they don't have to... they love feeling special, getting the ring, getting a house and all that, it's the ultimate validation. I believe they may choose to not stay married unless they are forced to, but women definitely enjoy getting married. Men will marry if they think they will benefit, but what they expect and what they get are very different situations.
/r/TheRedPill13/04/15 07:42 PM
1

20% of men get 80% of women. That's why some men have huuuuuge partner counts while an unfortunate majority are <10.
/r/TheRedPill12/04/15 09:44 PM
12

A guy who finishes his residency single, over 5'6" and under 200 pounds guarantees himself an 8+ if that's what he wants. He wants DOZENS of 8+'s! Women put doctors in the BB category, and wall-approaching women will claw each others' eyes out to get and keep this kind of guy. You have to really know what you're doing to harness that into a plate situation.
/r/TheRedPill12/04/15 09:43 PM
9

THEY ARE CALLED UNICORNS BECAUSE THEY DON'T EXIST.
/r/TheRedPill12/04/15 06:21 PM
9

Stay aloof. Eat at your desk, "Sorry, too busy, we'll catch up later." It's important that you not seem snooty, though, so you can find out where they are going and show up for just the last 10 minutes or so. It minimizes the amount of time, but shows you are theoretically open to sharing their company. Listen when it's required, but don't judge. They just are who they are and they are not likely to change.
/r/TheRedPill12/04/15 06:20 PM
1

A small-town doctor would, in my opinion.
/r/TheRedPill12/04/15 06:17 PM
4

I've heard this from my doctor friends. A friend-of-a-friend is a surgeon, he never tells non-medical profession women that he is a surgeon before he gets her in bed. If she's medical profession, though, being a surgeon carries alpha connotations so he is more open about it. Some women will ask you straight-up what you do, though. I don't know how to evade that without triggering alarms.
/r/TheRedPill12/04/15 06:14 PM
7

TL;DW -- women working outside the home is why marriages are failing.
/r/TheRedPill12/04/15 06:10 PM
3

One of the girls mentioned a "hall pass". Plates can have hall passes, hell, their whole life is a hall pass, it's not kind to try to lock down a woman you have no interest in being monogamous with. If she's an LTR, though, hall passes are for pussy men who are deserving of disloyalty according to evolutionary/hypergamy rules.
/r/TheRedPill12/04/15 06:07 PM
2

So just learn to enjoy the superficial exterior Yeah, this is harder than it seems. I think relocation abroad is the ultimate solution for me. (If you bring the woman here, she takes on the characteristics of the locals.)
/r/TheRedPill12/04/15 05:50 PM
7

Be careful rejecting a co-worker. Women hold grudges for that shit. You need to give her some good hamster food why you rejected her... the best hamster food is that you're either gay or taken.
/r/TheRedPill12/04/15 05:48 PM
2

I read Athol Kay and I think he tries to balance what men and women both want... he ends up conceding too much to women, in my opinion. He's right about a lot of stuff, particularly the 50% chance to end your marriage when you implement reclaimed masculinity.
/r/TheRedPill12/04/15 05:42 PM
2

My friend-of-a-friend (call him Jack) is alpha as shit. He never AMOGs because no one else is worth it. Average height, good physical shape, good fashion sense, 40 y.o. who nails 20-somethings and 30-somethings on the reg -- any woman who catches his eye, really. Never been married, but has plates from blonde girls-next-door to Brazilian yoga instructors. He's been slaying poon since his frat days at Ball State University (yeah, literally) and has been the object of his college buddies' envy as …
/r/TheRedPill12/04/15 05:40 PM
4

It's what a man who knows what he wants would do.
/r/TheRedPill12/04/15 05:32 PM
5

Yes and no. You need a good and valid reason to not have banged your friend, because otherwise it's negative social proofing. If you want female friends to open your social circles, pick fat and ugly girls. You can actually be good friends to them, helping them improve -- they can become altruistic outlets for you. Just don't get too drunk around them and have a regrettable "incident". clears throat awkwardkly
/r/TheRedPill12/04/15 05:27 PM
-1

But it IS an insult for a woman >seriously< to believe that you are the kind of man who would accept the post-play friendzone This is a very strong point. Best to not dwell on the insult, though, but use it as a motivator to improve.
/r/TheRedPill12/04/15 05:26 PM
7

Last time I was out with a wingman I hit on three women. 1) One was a grenade, I don't even count that as a rejection. 2) One was an attempted plate (divorced mom, age appropriate) -- got the number but follow-up would have been too much work, therefore if there was a rejection it was me rejecting her. 3) One was a girl dancing provocatively with her girlfriend -- tried to go up and dance with her, but she rejected me flatly suggesting that I was too old. No problem, move along, she did me a fav…
/r/TheRedPill12/04/15 05:21 PM
1

I guess you're right, you really can't lose, good perspective!
/r/TheRedPill12/04/15 02:39 PM
4

The thing is, if a woman plays her cards right, she can turn a pick up in a club into a relationship. It's like Beige Phillip says -- they just have to wear us down. This is Dante's "jelly bean jar" analogy: every nice and Charming thing she does puts a jelly bean in the jar of your relationship. You might have a bunch of jars, but whichever jar is the fullest is the girl you get along with the best. If she just hangs in there, keeps filling the jar (without taking jelly beans out by being unple…
/r/TheRedPill12/04/15 02:36 PM
1

Backpage has an actual category for it. Mind you, I've never used P4P, so I can't give any other advice than what I heard given from a sex columnist to a disabled guy who was worried about getting busted: if you don't have sex, it's not a crime, so the first time just get to know the woman, and then later times with that same person the companionship can mean whatever you like.
/r/TheRedPill12/04/15 02:27 PM
2

You look paranoid because you're bringing up something that happened two years ago and was supposedly settled. I agree that if you harbor doubts still after two years, you are with the wrong person. Asking is still lose-lose-lose, though.
/r/TheRedPill12/04/15 05:32 AM
12

She was a victim of her upbringing. She was the counterpoint to Forrest's success. She succumbed to the dark means of dealing with her trauma, where Forrest compensated via achievement and bravery. He probably loved her because he understood her, better than any of us could, and that she was a tragic figure. Perhaps he didn't even care if the kid was his, the point was this child had an opportunity to escape the horrors that Forrest and Jenney had experienced as children.
/r/TheRedPill12/04/15 05:30 AM
1

Yeah, but if the uggo's start giving me 'tude, I realize I really don't want to talk to a woman who is unappealing in multiple aspects. I'm sure they feel the same about me by that point, so I do us both the mutual favor of nope-ing the fuck out. I usually only talk to uggo's when I'm on wingman duty or if I'm really, really bored.
/r/TheRedPill12/04/15 05:23 AM
1

If you give her enough tingles, you'll satisfy her hypergamy.
/r/TheRedPill12/04/15 05:08 AM
1

If you put your house in the trust, and you are the trustee, but you pay your trust rent (an actual check, every month, fair market value), does that make you a beneficiary? So as long as you treat your trust as a landlord, that makes you not a beneficiary so you can still be the trustee? Or are you too conflicted at that point?
/r/TheRedPill12/04/15 05:05 AM
2

Lose-lose to ask. 1) She told the truth. You look like a paranoid asshole. Relationship damaged. 2a) She lied and confesses. You were right to be suspicious and can't forgive the lie. Relationship ended. 2b) She lied and keeps quiet. You still don't believe her, but she is angry you don't trust her. Relationship damaged. Asking has no good outcome.
/r/TheRedPill12/04/15 04:53 AM
2

You think you want that, but you actually don't. Believe me, you don't. It doesn't make it hurt less.
/r/TheRedPill12/04/15 04:08 AM
3

My girlfriend (19) want on a trip to Ireland with her close friends Alarm bells. Red lights. Sirens. If your woman goes anywhere on vacation without you, she is vulnerable. Not to rapists or whatever, but to influence from her friends (who have other interests than yours in their forethoughts) and to seduction from strangers. Women are not made of wood; they respond to social cues and sometimes the response is fucking. I get a call from her and she is crying hysterically. That's a fuck call. She…
/r/TheRedPill12/04/15 04:04 AM
2

A cunning pun.
/r/TheRedPill12/04/15 03:46 AM
4

Oh absolutely. Hence the last line of my post. As you said, though, male hamsters are more likely to speak Reason than Feeling, but the Reason isn't dispassionate so it is not Truth. Most humans hate Truth, though, so they go with the most palatable derivation thereof, namely Reason or Feeling.
/r/TheRedPill12/04/15 03:39 AM
9

My personal favorite is when girls go on fb rants about how there's no more good guys out there. Either they're not getting out enough, or they treat good guys like shit. Men who are not attractive are invisible to them, literally beneath their notice. Thus the men they are actually attracted to (approximately 20% more SMV than the woman has) are not available for dating/relationships, hence the women have a valid complaint. I don't blame them in the least for not settling for a lesser guy. It's…
/r/TheRedPill12/04/15 03:24 AM
6

I see them as a double-bonus: 1) The breasts look good and enticing all night, especially with bonus cleavage. 2) If they are small when the bra comes off, they are more likely to be shapely. But I'm an eternal optimist.
/r/TheRedPill12/04/15 03:20 AM
3

The question is this: which is more likely to persuade the average women, Reason or Feeling? If she is more persuaded by Feeling, which would she be more likely to use to persuade herself? The outcome is the same whether she has naked self-interest or leads herself into self-delusion (the internal persuasion of Feeling == hamster); whether it is cold and calculated or self-deception is, in effect, moot. Which, however, is more likely? Self-deception. Humans love to lie to themselves.
/r/TheRedPill12/04/15 03:16 AM
2

That is the most brilliant and refined misogyny I've ever read. I pity the author a bit, but I admire his mind.
/r/TheRedPill12/04/15 03:10 AM
3

Never used P4P, but a brief scan of backpage suggests it's $100/hr for 6's in their 30's, and $200+ an hour for 8's in their low 20's. That's in a large-ish Indiana city, so it should give a fair idea of prices in the midwest U.S.
/r/TheRedPill12/04/15 02:56 AM
2

Oxytocin is available medically. They give it to women during/after delivery of a child/children. http://www.drugs.com/cdi/pitocin.html
/r/TheRedPill12/04/15 02:54 AM
16

Have at it, Sisyphus. As for me, if my rock is going to be at the bottom of the hill no matter what? Fuck it, bust out some beers and a lawn chair, rest my feet on that motherfucker.
/r/TheRedPill10/04/15 03:00 AM
2

Rather than King of Manginas, I view more of a Bill Clinton type persona.
/r/TheRedPill09/04/15 08:52 PM
4

If they understand that he is powertalking, he will not be excluded. Quite the contrary, he'll become a valuable asset.
/r/TheRedPill09/04/15 03:01 AM
1

Truly excellent and successful people don't fit in. It's in the definition of "excel(lent)".
/r/TheRedPill09/04/15 03:00 AM
2

It seems a number of you think the world works the way it should work. It doesn't. You can't change it. Many of you don't even seem to understand it. You can all extol the virtues of the manly coal miners who earned an honest day's pay for an honest day's work all the way up until they died of lung cancer. Great. Those dudes are heroes. But it was the management who profited from the loss of those men, and I won't fault anyone for playing the Machiavellian long game to get their hands on that pr…
/r/TheRedPill09/04/15 02:58 AM
2

You shouldn't be making enemies at work, period. I don't know where you men get the idea that keeping your head down means you'll never take a bullet. Nope. Not the case. Not by a longshot. This guy is playing the game aggressively. He will make it towards the top, watch. It's always the worms who feast in the end, on the dead carcass of better men's efforts. You men value manliness but that is now how major businesses work. If you are in a cubicle or office environment, there is a Game, and whe…
/r/TheRedPill09/04/15 02:55 AM
2

This is the way it should be. However as organizations grow the true innovators/leaders and the people who do actual work shrink while the middle bureaucracy grows out of all proportion. That is the natural life cycle of an organization. Your merit will serve you well in a smaller or less mature environment, but when everyone is fighting over the middle management scraps your ethics are going to leave you scratching your head. Be ruthless, or be prepared to leave with your shit in a cardboard bo…
/r/TheRedPill09/04/15 02:52 AM
1

This reminds me of when women say, "Oh, not me. I'm not like that." Every place has commonalities and differences, and it's our job as rational thinkers to decide which is which for ourselves. You are essentially objecting by stating the obvious, here.
/r/TheRedPill09/04/15 02:48 AM
1

I agree. But an alpha feminist... now there's someone who can be dangerous.
/r/TheRedPill09/04/15 02:47 AM
2

That's just it - as long as he comes at them from the left, he's invulnerable. The worst they can do is stymie his progression, but there are always other companies.
/r/TheRedPill09/04/15 02:45 AM
1

It has even more power coming from a dominant, successful male. Women despise effeminate feminist men, but a man who is otherwise powerful and successful spouting their own crap back at them? Irresistible.
/r/TheRedPill09/04/15 02:43 AM
2

If he were handsome, successful, well-dressed, portrayed confidence and spouted feminist game... I'd mark him as a powertalker and someone to be reckoned with. You should too. I know a 6'4" gay man who is the biggest HR powerhouse I know. He's bulletproof in many ways because of his sexuality and interpersonal dominance -- I'd never fuck with him in a work environment. Or out of a work environment, the dude is massive.
/r/TheRedPill09/04/15 02:41 AM
2

Incorrect. Many women are intimidated by the blather of "their" own intellectuals. They think with their feels, remember, so if you can give their hamsters food they will worship you. Sure he destroys other people with his feminist language and terminology, but the real success is in making them think they deserved it. It's the most horrible aspect of rape -- a truly horrifying aspect of a terrible act -- that women internalize it and think that someway, somehow they are themselves to blame for …
/r/TheRedPill09/04/15 02:37 AM
2

Try a coffee shop near a college for day game, bars in or near hotels (for traveling businesswomen) at night. Just a thought.
/r/TheRedPill09/04/15 02:09 AM
0

Is this post sarcastic? Because you seem sincerely clueless.
/r/TheRedPill09/04/15 02:02 AM
2

By BPD you mean borderline personality, correct? http://www.nimh.nih.gov/health/topics/borderline-personality-disorder/index.shtml I dated one, and felt very lucky not to be beat down with a baseball bat when I broke up with her.
/r/TheRedPill09/04/15 01:55 AM
2

I should have just used the link you provided to a site describing the situation in English. Oh, wait...
/r/TheRedPill08/04/15 10:27 PM
1

Ok, so a person I know had 3.8 and 28, got an interview, barely got in. Hm, checks out.
/r/TheRedPill08/04/15 08:39 PM
2

31 MCAT is top 20%. It won't get you to Princeton, but I said a state school, which I have directly observed. If someone succeeded, then they were by default, competitive. No one is saying a 3.1 GPA is good. https://www.aamc.org/students/download/85332/data/combined08.pdf
/r/TheRedPill08/04/15 08:36 PM
-2

Frame isn't pick-up; frame is everything. How's this for stating exactly what I mean: YOU ARE WHINING LIKE A PUSSY BITCH OVER SHIT THAT DON'T MATTER.
/r/TheRedPill08/04/15 01:04 AM
8

He's got to want it. You can't make him change. The Blue Pill is just as addictive as other types of pills.
/r/TheRedPill08/04/15 12:57 AM
0

And really? What's with the passive aggressive, pseudo intellectual garbage to start your post? If there's a flaw in my logic point it out. Otherwise get to the damn point. Take that bitch behavior elsewhere. Why are you losing frame? I'm not even trolling you but you're acting exactly as if I were. Who gives a shit what I say; take what you want and leave the rest as immaterial, because it is.
/r/TheRedPill08/04/15 12:54 AM
13

Now, why would the government ever lie to us about inflation? It says inflation is 0%, but the prices of things I actually buy keep going up? Hmm, must be those greedy shopkeepers and not the altruistic, paternalistic, definitely-has-my-best-interests-at-heart government. http://www.shadowstats.com/alternate_data/inflation-charts
/r/TheRedPill08/04/15 12:42 AM
0

I hate that phrase... All other factors being equal.... NO SHIT An overemphatic response is suggestive of a perceived weakness in your logic. It is necessary that we use generalizations to escalate the dialogue. Anyways... If you then admit that intelligence is an advantage, the next step is to determine to what extent is it an advantage? Is it similar to a full head of hair later in life, or more similar to height advantage? Etc. etc. Or, you could just say fuck it, it's too hard to measure, si…
/r/TheRedPill08/04/15 12:39 AM
1

People admitted with minority status are referred to minority organizations, and also to a director of diversity or something like that. I guess if you were really quiet about it and ignored all that stuff it would be okay, but I am sincere about my heritage despite it not being obvious from my appearance, so that's how the ignorant dude knew about me.
/r/TheRedPill08/04/15 12:34 AM
3

http://en.wikipedia.org/wiki/University_and_college_admission#Brazil So, they used to have big tests, and now they have a national test, sort-of, and now they are trying to do quotas? What's the big deal?
/r/TheRedPill08/04/15 12:31 AM
2

3.1 and 31 mcat is competitive for medical school 31 MCAT is definitely competitive. I've known a lot of people with lower who made it into a state medical school. And a 3.1 GPA does suck, you're correct, but you will still get an interview and a chance to explain yourself, especially if you apply a second year in a row.
/r/TheRedPill08/04/15 12:27 AM
1

No, they don't. They don't challenge you in any way. Like a previous poster said, they like to have more minorities on their paperwork. People will know, though, and it will come up, behind your back perhaps. I am enough of a given minority to appear completely caucasian but I get some advantages as well. One guy I knew, a co-worker, was going off about minorities and lumped me in to his argument. It was inaccurate and unjust (my test scores were 2 full SDs higher than the other guy he was talki…
/r/TheRedPill08/04/15 12:20 AM
6

Ugh, don't do it. I thought about having a LTR with an Asperger chick, that one was just waaaaaaay too much work. Much more exhausting than a "normal" woman. If you want a project to undertake, be my guest, don't let me stop you, but it is not a solution by a long shot. You think you have good frame? Try getting an Asperger girl to enter your frame, when they don't even realize what the fuck a frame is. (Reality is just reality; there are no interpretations of it.)
/r/TheRedPill07/04/15 11:52 PM
0

All other factors being equal, height/resources/physical prowess, etc... If one man is much smarter than the other, similar, yet less intelligent man... Over time, which man will find more success in an industrial or post-industrial society?
/r/TheRedPill07/04/15 11:42 PM
3

More than 145 is crazy, in my book. I mean, you probably need pills. You're too smart, sorry.
/r/TheRedPill07/04/15 11:40 PM
6

steady rate of inflation You're adorable. http://www.investopedia.com/terms/q/quantitative-easing.asp
/r/TheRedPill07/04/15 11:24 PM
11

Bridesmaid dresses, however, seem to offer protection from the libido-destroying effects of wedding cake, if-ya-know-what-I-mean.
/r/TheRedPill07/04/15 09:41 PM
24

The exact wrong way to be 'scientific' is to start with a conclusion and then start gathering evidence. Source: the Pentagon
/r/TheRedPill07/04/15 09:39 PM
47

That's about when I start to criticize the set design.
/r/TheRedPill07/04/15 09:38 PM
14

There was a heavy dose of sarcasm all through that video, from handing the woman the "D", to getting her into your car, etc... I think the real subtext was PUA.
/r/TheRedPill07/04/15 09:37 PM
37

Even after all that explanation, the 2nd commenter down (who may have been male) still takes the time to tell him how he is wrong to be "only 97%" feminist. My. God. What. The. Hell.
/r/TheRedPill07/04/15 09:31 PM
2

Ultimately you need to learn to gauge the situation. For cold approach, my thought is that if the connection energy (I can't describe it more clearly than that) isn't there within 2 minutes (less is better), then it probably won't be and you should just move on. If the conversation is good, though, it will feel like a natural thing to either move the conversation to another location, or to get her contact info so you can get a hold of her later. If you have her contact info and text her later, j…
/r/TheRedPill07/04/15 07:57 PM
0

An impact factor 2 sociology journal and a wikipedia page? Hmm... color me unconvinced.
/r/TheRedPill07/04/15 03:10 AM
1

Definitely not. I've been over there a few times and they talk about valuing their own femininity, how to attract and subsequently not destroy manly men, etc. etc.
/r/TheRedPill07/04/15 03:07 AM
18

your work husband Nope. I'm out. That phrase alone is enough. Goodbye. Have a nice work-life with your work-husband and your 2.5 work-kids in your white-picket-cubicle. Goodbye.
/r/TheRedPill07/04/15 03:04 AM
2

If she knows ahead of time, it even incentivizes her to be sure she's not getting her AFs raw dog.
/r/TheRedPill07/04/15 02:58 AM
4

We talk a lot on here about women denying access to a man's children, and how unjust that is. Here is just one instance where she can't quite screw him over even if she was screwing around.
/r/TheRedPill07/04/15 02:54 AM
21

Don't tell the girl you want a "date". Tell her you want her to come over and "chill", "hang out", "relax", or straight up "fuck". If you say "date" they have a concept of what that means, and the negative connotation of fucking on a first "date". If you're just "hanging out" then one thing can lead to another.... That's what he's getting at.
/r/TheRedPill07/04/15 02:47 AM
7

Eh, it's alright. You're better off than you would have been. Just keep layin' the bricks and you'll get there eventually. Some guys are gifted with game or money or looks or whatever, but if your life is what you want it to be then you are headed in the right direction. I'm not saying you're a special snowflake who deserves love the way you are, fuck that noise, no, what I'm saying is that your life is in your own hands and if it's tough temporarily that's just a phase you have to get through.
/r/TheRedPill07/04/15 01:44 AM
21

People have said that about my ex as well, that she'll be knocking on my door any month now trying to get me back. Fuck that. Let her think I'm a loser moron that she was better off getting rid of... her opinion doesn't matter at all. If it did, that would mean she mattered, which she doesn't. I'd like anyone to think well of me, of course, that's a human thing. But her specifically? Nah. Fuck it. She's a nobody now.
/r/TheRedPill07/04/15 01:41 AM
4

Why do you give a shit what people on the internet think? You are clearly losing frame here.
/r/TheRedPill07/04/15 01:29 AM
1

The editor replied in a different article that no firings would happen and that she would continue to write for RS.
/r/TheRedPill07/04/15 01:16 AM
1

Didn't this get a fraternity banned/shut down/disciplined? They voluntarily ceased activities on that campus.
/r/TheRedPill07/04/15 01:07 AM
1

I go full on super nice, begging for sex, and drop what I'm doing and go help her any time she asks. I do that and they remove themselves from my life without drama, and without legal issues in two weeks or less. This hasn't worked for me. My guess is that my masculine frame wasn't strong enough from the start, so the dramatic shift isn't as dramatic. I'm sure it would work eventually, but it's annoying in the meantime.
/r/TheRedPill07/04/15 01:01 AM
2

He said she doesn't have the money to fight it. Of course all money in a marriage is joint money and she can theoretically force him to pay for both attorneys, but he states that what she's likely to get isn't worth it. People think in a divorce the man gets half, the woman gets half, but what really happens is that the lawyers get almost all and you get what's left.
/r/TheRedPill07/04/15 12:21 AM
15

It's precisely how a teenager acts. If they have a job afterschool, that money is for them. They don't start paying you rent, or chipping in for groceries or utilities. A good parent might make them spend it on a car/insurance/gas, or save it for college, but the teen always views it as rightfully and justly their own. Women do the same, if you let them.
/r/TheRedPill07/04/15 12:19 AM
1

I don't know where Dante Nero got "time travel", but I got it from him. Women I mess with aren't DTF like that with me, where I just invite them back to my place for a drink. I've done it, and it doesn't work. Women need a little more time with me before things get going.
/r/TheRedPill06/04/15 08:51 PM
1

It's not complex, really. You just have to get a place or two that you already like and are familiar with. Then go where you always go. I guess the women I mess with aren't quite so DTF as your women, which most likely has something to do with me.
/r/TheRedPill06/04/15 08:48 PM
31

She told me how she felt kinda bad and that maybe she should give him a "pity fuck," because he's made several advances and she keeps turning him down. But she doesn't want the ride to end so she feels "obligated." Her words. She already did, has a couple of times, I bet. She's not really into it, of course, but that's the price of a guy who can get her brag-worthy stories for her friends and her hamster.
/r/TheRedPill05/04/15 11:43 PM
2

Nor have I hooked up with a club skank, but occasionally there are decent-appearing women out at dance clubs. You can usually spot them because of 1) their non-slutty clothing, 2) they are dancing with their girlfriends and not in an explicit manner, and 3) they are not excessively inebriated. Are they likely to be nun-like in their virtue? No, but who really is anymore?
/r/TheRedPill05/04/15 11:36 PM
4

Now you know with clarity that your relationship is intolerable. Yep. Exactly. Gave me the impetus to end a relationship that needed ending. Go to 40 seconds in: Louis CK on divorce https://www.youtube.com/watch?v=SoRKaq8VhOU
/r/TheRedPill05/04/15 11:25 PM
1

(I was kidding, no harsh tone intended. Carry the fuck on, fuck-os!)
/r/TheRedPill05/04/15 11:16 PM
3

The above link is a Sam Kinison clip. (When posting links, please describe what they are.)
/r/TheRedPill05/04/15 11:15 PM
-1

Fuck that. I fucking love the fuck word. It's fucking awesome and I fucking use it every fucking chance I get.
/r/TheRedPill05/04/15 10:48 PM
6

Asshole drunks are always around too, and even if you do get a little something going on with a woman or two, the drunks will bust that shit up A.S.A.P. just being dicks.
/r/TheRedPill05/04/15 10:41 PM
24

He needs to learn how to "time travel" from Beige Phillip. Go to place #1, where you are known and know the staff. (For me there is a coffee-shop-bar around the corner I go to a lot.) Then place #2 where you are, once again, known and know people. (Favorite pizza place, 4 blocks from my house.) Then go to place #3. (Clubs or bars, where you can show outcome independence by paying not much attention to her and looking at other women... the push of push-pull.) Initiate non-sexual touching at place…
/r/TheRedPill05/04/15 06:21 PM
1

Capable of flying the space shuttle? NAWALT. Evolutionarily programmed for hypergamy? AWALT. There are some women who are whore prodigies, as Beige Phillip says.
/r/TheRedPill05/04/15 04:58 PM
2

Flattery is undeserved praise. Yours is deserved. As for insight... So, serious question: what issues are there? I'm trying to reconcile the TRP view that women's adulation of us doesn't matter because they are essentially subordinates, unless if they've swallowed a half-furlong of cock, then it somehow impugns our dignity to be with them. You think that a man's interest in a woman's number has anything to do with her relative fitness for interaction. No. It is a surrogate for her cynicism. A cy…
/r/TheRedPill04/04/15 11:08 PM
1

Read the sidebar. It's not work, it's truly enjoyable.
/r/TheRedPill04/04/15 11:03 PM
3

Sure, but that's a separate tangent that is beyond the scope of the OP. No, I don't think so. Beta game is ideal for relationships. What's the point? The sex is the point. Incorrect. Women can offer Charm and can create enjoyable experiences. There are also women who have excellent brains and can be subject matter experts. The key is to remember that they do not think the same way that men do, but that can be an interesting view on the world. If women were only good for sex, I would go MGTOW, be…
/r/TheRedPill04/04/15 10:56 PM
1

It was a very minor point. All felonies (at least in most states, AFAIK) are considered as crimes against the state, but some allow for damages (e.g. RICO also allows for damages, IIRC).
/r/TheRedPill04/04/15 08:52 PM
2

Once you've either reached a certain age, or had enough sex, you just start to say, "What's the point?" You're past collecting scalps, you're ready for something else. Women can be enjoyable companions so long as you remember what they actually are, hence the RP tendencies. Relationships are not bad things so long as you are in control of yourself and respect yourself.
/r/TheRedPill04/04/15 08:51 PM
2

I winged for a buddy last night, I didn't even attract the mother hen -- I just kept her distracted. She was a Beige Phillip "bear" and I'm more of a "deer" guy, but I didn't let her get bored so he was able to hit on the little cute one (a "bunny"). (If anyone doesn't know what that means, check out the Beige Phillip episodes with Jeffrey Gurian.)
/r/TheRedPill04/04/15 08:49 PM
1

In the future, please do not just provide a link, but mention why you think it applies and your interpretation of its relevance. In this case it is self-apparent, true, but we don't necessarily have any reason to click it unless you tell us what it's about. Thanks for the link, though... good article.
/r/TheRedPill04/04/15 08:37 PM
1

I think for the most part a full and true beta as described by TRP is the man who is consistently taken advantage of by women. I think that is the definition around here, wherein it really describes bluepill betas.
/r/TheRedPill04/04/15 08:30 PM
3

A "Red Pill Beta" is just an idiot who hasn't learned his lesson. I disagree. Beta means comfort, alpha means excitement. Women are DTF alphas for the excitement or the story, but at different points in their cycle they want different things. Beta orbiters do get laid sometimes... even the dude who got used for schoolwork (his FR is on TRP frontpage now) still got laid by the chick using him. The reason that BP betas get laid so rarely isn't because the chick isn't willing, it's because be BP-be…
/r/TheRedPill04/04/15 08:26 PM
1

That's why wingmen are so handy, for distracting mother hen.
/r/TheRedPill04/04/15 08:15 PM
4

*horde (Don't mean to be a dick, just offering the correct spelling.)
/r/TheRedPill04/04/15 04:31 PM
10

Whenever I see "trigger" as a verb, it triggers me to laugh.
/r/TheRedPill04/04/15 04:24 PM
2

That was a joke, my friend.
/r/TheRedPill04/04/15 04:23 PM
4

I dont think the Gf/Wife/SO even know they are doing it They usually know that they are doing it but they don't know why.
/r/TheRedPill04/04/15 04:23 PM
1

Seconded. Although BP example is already TFINTG, pretty much.
/r/TheRedPill04/04/15 04:21 PM
1

Some guys have such low self-esteem they can't tolerate being thought of poorly by anyone for any reason. Source: recovering "nice guy".
/r/TheRedPill04/04/15 04:18 PM
1

Yes, it's fine. But there's a 6th sense guys have about women's signs of interest. It's easy to spot when she's got them for you, but even easier to spot if she's got them for others.
/r/TheRedPill04/04/15 04:14 PM
2

listen to your own crazy Beige Phillip rule: if you feel a tingle in your nuts, you are about to be kicked in the balls. For the new guys, Beige Phillip is a podcast by a couple of comedians who are hilarious and very informative about how to handle relationships from a male perspective. I listen every week. http://beigephillip.com/
/r/TheRedPill04/04/15 04:09 PM
3

The day I see a woman changing her own tire, let alone in heels, I will pull over to take a picture. That day has not yet come.
/r/TheRedPill04/04/15 03:50 PM
1

Noble women stayed out of the sun to preserve their light skin and light hair and thus look younger for longer.
/r/TheRedPill04/04/15 03:49 PM
5

When the craziest chick I've ever dated broke up with me, she got her gay friend to call me up and proposition me. Another time I also got random texts from a "gay guy" trying to proposition me for oral sex when my relationship was basically ending (I was ending it basically for lack of blowjobs, which I guess only gay guys enjoy, apparently).
/r/TheRedPill04/04/15 03:47 PM
1

Conspiracy does allow for damages against the victim.
/r/TheRedPill04/04/15 03:42 PM
1

These hoes should be charged with obstruction of justice. Criminal conspiracy, major felony. http://en.wikipedia.org/wiki/Conspiracy_%28criminal%29#United_States
/r/TheRedPill04/04/15 03:34 PM
0

Your manner of expression is excellent. You lack insight, however.
/r/TheRedPill04/04/15 03:22 PM
1

It's been my experience that if they think their pussy is golden, their count is a little lower. Supersluts know to use other orifices to bring pleasure.
/r/TheRedPill04/04/15 03:21 PM
5

This was sarcastic, I hope.
/r/TheRedPill04/04/15 03:19 PM
0

Anything can happen once. Fucking another man at your own wedding, AWA definitely not LT, but some women are. It's more useful as an illustration of a concept, more like a parable or homily, than an actual cautionary tale. But, some women ALT.
/r/TheRedPill04/04/15 03:15 PM
2

Why did her friend tell you the actual count? That's kinda weird.
/r/TheRedPill04/04/15 03:13 PM
23

hide promiscuity They know. They wouldn't hide what doesn't matter. That's why if you are only good for hooking up (not LTR material) and present a non-judgmental attitude they will tell you all kinds of crazy shit, but if you are BB material, she's only been with that one guy that one time, and it was sooo uncomfortable... yada, yada, yada.
/r/TheRedPill04/04/15 02:59 PM
9

Not all of them are like this, but the ones that aren't tend to be shy and so you won't interact with them nearly as frequently as the users. Don't go for shy/awkward women. When they come out of their shells they are exactly the fucking same. AWALT = A-fuckin-WALT.
/r/TheRedPill04/04/15 02:48 PM
1

What's 2nd base, outside the clothing?
/r/TheRedPill04/04/15 02:45 PM
9

One chick made me hummus once, which was really awesome. No substitute for BJs, though.
/r/TheRedPill04/04/15 02:42 PM
1

The fuck are you talking about? Primers are only one strand and listed 5'-3' by unspoken convention. They can be literally any combination of G, T, C, and A in any order. Are you saying nowhere in the human genome is there a sequence of "ACGG" on a single strand? You are either 1) confused or 2) talking out your ass.
/r/TheRedPill04/04/15 02:26 PM
1

Lying to stay out of trouble is what adults do. Definitely adults do, but we all started doing it as children.
/r/TheRedPill03/04/15 11:15 PM
1

Yeah, I'm not about to browse pubmed for sequences to put in a reddit comment.
/r/TheRedPill03/04/15 11:10 PM
1

I've heard that therapy dogs are extremely helpful for almost everyone who's tried one.
/r/TheRedPill03/04/15 11:09 PM
36

Despite what you think, no woman will stick with you in times of worse, so don't let them take your better. This is the true heart of oneitis -- men dream of the One who will stay with them and show loyalty always and forever. It's such a powerful dream that we all recognize it instantly, and in my heart of hearts I still call myself a cynic for denying its existence. Certainly women do stand by their men through terrible times, but the cynic in me asks... what was the alternative? What else mig…
/r/TheRedPill03/04/15 12:49 AM
17

I hate to argue about something I am largely ignorant of, with someone else who also seems ignorant.
/r/TheRedPill03/04/15 12:05 AM
0

Eh, it's good you didn't get the work-girl. Sounds like a One-itis situation.
/r/TheRedPill03/04/15 12:00 AM
5

Mouth cancer and heart disease. People always forget about the heart disease...
/r/TheRedPill02/04/15 11:42 PM
8

Fear: being aware of the consequence of your actions (deterministic). Terror: your actions have no consequence on outcome (random). If you know you can lose your life by lifting the edge of your shield too high, you keep the edge of your shield down and fight like hell to live. You are in grave danger, but have (the illusion of) power to save yourself. If you or your buddy or a completely empty iron hulk could be vaporized at any moment by any pot-shooting 12-year-old with an RPG, nothing you do…
/r/TheRedPill02/04/15 11:36 PM
1

Well, there was no Internet until I was an adult. I used to watch movies on VHS tapes and look for books in the card catalog at the library. "Alf" and Hulk Hogan aren't campy/ironic to me -- I actually really liked them when I was a kid, and I know nothing at all about Pokemon. So, a similar temporal frame of reference would also remember some if not all of that stuff, and not act bemused/befuddled when they make an obscure Team Rocket joke that I don't get.
/r/TheRedPill02/04/15 11:27 PM
3

your buddy there didn't even have the chance to first get to know that lady in normal human terms and decide whether or not he liked her as a person He would have rejected her regardless. Most men have few "hard-no" objections, but corpulence is one of them.
/r/TheRedPill02/04/15 10:36 PM
4

Female friend in question freaks out, saying she has a disorder which leads her to be overweight, and, among other things, says "how can you judge someone over something they have no control over?" He is not a high value male in her eyes. He should be grateful to get any woman to pay attention to him, and only a fatty is desperate enough to consider him. She doesn't think that way in her head, of course; she just wants him and her to "be happy". Chicks always think that way -- as if there were s…
/r/TheRedPill02/04/15 10:26 PM
1

I haven't watched the show enough to know exactly what would happen, but it would be gloooooorrrious, I'm certain.
/r/TheRedPill02/04/15 10:20 PM
1

Indubitably! I would never suggest the contrary. In my biased opinion, most degrees are fairly useless certifications of pre-testing for on-the-job training. The few degrees that I know of that actually teach you how to think include: 1) STEM (mostly PhDs, but engineer BS is good) 2) Philosophy BA/BS 3) JD They teach you to think in different ways: 1) PhD/philosophy = critical thought, 2) engineer/technical = practical thought, 3) JD = rules are only rules if you believe in them.
/r/TheRedPill02/04/15 10:17 PM
3

I don't know about stress, but nutrition is important. Children of observant Muslim mothers who fasted during Ramadan while pregnant lag behind their classmates in many categories. Muslim clerics have since issued a judgment/decision that it is good for a woman to honor Ramadan, but if she is pregnant she can honor the holy month by fasting next year.
/r/TheRedPill02/04/15 09:59 PM
1

He wouldn't laugh and run offstage. He'd just sigh, shake his head, and say, "I fuckin' knew it already." The ex's boyfriend would be the one running around on the stage then.
/r/TheRedPill02/04/15 09:55 PM
2

Did your lawyer get a good laugh, too?
/r/TheRedPill02/04/15 09:47 PM
0

The way that the paternity test is done is that you have to have something to compare it to. They take some of the (presumed) Dad's DNA, and some of the child's DNA, then run tests on both sets. If they have certain markers in common (both have ACGGCCTTAGCCGGTCCCATAATT, for example), then that increases the likelihood they are related. Well, actually, it DEcreases the UNlikelihood, but, there ya go. If they have one marker in common, that is 1/2 chance of being random, with each successive marke…
/r/TheRedPill02/04/15 09:45 PM
-1

I could build a PCR for ~$1000, materials about ~$25 a test, with an error rate of 1/16. I charge you ~$50 for the pre-test, if you still question you pay the $600 for the real deal. I'd have a lot of takers, I bet. (Legal mumbo-jumbo... )
/r/TheRedPill02/04/15 09:36 PM
1

Just not attractive to me. Like some people can't handle a single crooked tooth (I think that a bit of snaggletooth makes a girl prettier sometimes)... it's a preference. I would like a woman who shares my similar temporal frame of reference.
/r/TheRedPill02/04/15 09:27 PM
1

True, but the PhD makes you far more attractive. A master's takes a lot less time. (A PhD is unique because it is not a certification, it is a way of thinking. When you can think good, you're done.)
/r/TheRedPill02/04/15 09:25 PM
0

Liberals don't like to be challenged in their orthodoxy. Neither do conservatives, of course, but anti-feminism and unfettered capitalism are conservative red meat, so conservatives feel more at home here than do liberals (despite the atheism). Also, liberals are pretty much pussy-whipped and only come here to WK.
/r/TheRedPill01/04/15 09:55 PM
2

One option: get a science PhD, then get a job at a patent law firm/business, and let them pay for your JD. I had a friend who did this. It was a long road, but he had no debt and earned a good living while going to night school. You have to genuinely like science and patent law, though -- that's the tough part.
/r/TheRedPill01/04/15 09:52 PM
1

I met one who is in medical school. She is an identical twin, probably a HB7 (no obvious flaws, a few nice features), but she is also 16 years younger than me... so I have no plans to pursue her. I do admire her, though.
/r/TheRedPill01/04/15 09:46 PM
2

Not true. Betas reinforce them constantly.
/r/TheRedPill01/04/15 09:42 PM
4

even if you don't really want the second product, 2-for-1 deals are always great If you can't get a 10... get two 5's.
/r/TheRedPill01/04/15 09:33 PM
1

I believe there is a correlation with a woman's cycle whether or not she will approach. I have no evidence to support this, however.
/r/TheRedPill01/04/15 09:32 PM
0

There are people with relationships that last, you guys know. There are a few out there. Not with me. I'm fucked. But my siblings, their marriages are solid. Sure, their wives got fat and the pussies got blown the fuck out by gargantuan-headed babies, but their marriages seem to have reached a level of equilibrium. They are naturally a helluva lot more alpha than I ever was, though, so they've got that going for them, which is nice.
/r/TheRedPill01/04/15 09:24 PM
3

Dick + Crazy = No. Nonononono. Nope.
/r/TheRedPill31/03/15 06:12 PM
2

Also most PUA material proposes following some type of script/formula, which can easily come off as unnatural. Not if she's drunk. I think that's the heart of PUA success(?). I don't do PUA, never have, but they do teach a few useful skills.
/r/TheRedPill31/03/15 06:06 PM
1

It reminds me of my first girlfriend, who was skinny but had a little belly. She always, ALWAYS complained about it, saying she wanted a flatter stomach. She asked me about exercises and shit. One day, after she was going on and on, I said "well maybe you shouldn't drink so much soda throughout the day." She broke down in tears and I felt like a fucking asshole. Classic 2nd degree manipulation. 1st degree is defiance, 2nd degree is guilt, 3rd degree is submission. They cycle through the degrees …
/r/TheRedPill31/03/15 01:06 PM
7

Women say one thing and then do another, i.e., "I'm not going to fuck you tonight," and then she fucks you. He said he would only hook up with her, which her hamster interpreted as he is open (but not easily) to get into relationship. I don't know if he meant it, but two BJs is its own mark of success.
/r/TheRedPill31/03/15 01:04 PM
2

it's not like they are extinct They never had a taste of the CC heroin, so they don't yearn for it. This generation of women has tried the CC and they will never forget it.
/r/TheRedPill31/03/15 02:46 AM
1

If we need to be in alpha mode all the time. You cannot be in "alpha mode". It doesn't exist. You either are, or are not, alpha, and pretending to be alpha is PUA shit. You do have to maintain a strong frame, which is far more attainable. If we cannot go down on shit tests, which are everywhere. Shit tests are an opportunity. She is testing your fitness, and if you are "fit", then she will love her vagina tingles that you cause all the more. Shit tests decrease in frequency if you are consistent…
/r/TheRedPill31/03/15 02:43 AM
0

Guys who are funny and confident can be Blue Pill all day long and land a hottie if they're lucky But they will never keep her.
/r/TheRedPill31/03/15 02:36 AM
1

The hard part is remaining unwavering in your approach. This is the most difficult part of turning from blue-to-red.
/r/TheRedPill31/03/15 02:22 AM
3

And that guy, while not exactly a unicorn, is pretty fucking rare. He's a rhinoceros. They're endangered and I think one species is actually extinct. http://www.mnn.com/earth-matters/animals/photos/10-animals-presumed-extinct-in-the-last-decade/west-african-black-rhino
/r/TheRedPill31/03/15 02:21 AM
6

Are you female? Then what the FUCK do you know about masculine energy? Talk about what you know if you actually want to provide some fucking value to this topic. Tits or GTFO.
/r/TheRedPill31/03/15 02:18 AM
5

I think it's the sunk cost fallacy. If you have begun to reach for something (having therefore already decided that you want it), and then it is slightly out of reach, you will stretch a bit further. Writ large and over time, this becomes stretching boundaries for a shaky relationship. You sunk effort in, which will be wasted and leave you looking like a fool if you quit now.
/r/TheRedPill31/03/15 02:14 AM
5

You are coming off here like a humorless twat.
/r/TheRedPill31/03/15 02:04 AM
1

No one can get any woman they see. No one. Thus, all women are controlling access to their vaginas, and are denying said access to at least some, and potentially all, individuals attempting to obtain it. Once they have given access, they seek to garner commitment from that male. That commitment requires the male's cooperation -- his is the veto. That's what I was trying to say.
/r/TheRedPill31/03/15 01:51 AM
1

This is absolutely true in my experience. Women are fucking bloodhounds at detecting insincerity because they are always insincere with one another. Men are rank amateurs by comparison. If you just are the awesome, self-improved guy that you are, making the most of your life and doing what you want, you may or may not pull bitches... but who gives a fuck, because you're having fun. (But you will pull bitches. They can't believe anyone can be genuinely self-secure and happy.)
/r/TheRedPill30/03/15 01:56 AM
2

I don't understand the context of your comment; if it was an insult it was not comprehensible enough to affect my emotional state, and was therefore a poor one.
/r/TheRedPill30/03/15 01:54 AM
7

The access to sex. If she is not controlling the access to sex, you are a rapist.
/r/TheRedPill30/03/15 01:52 AM
2

I'm a PhD biochemist -- I'm not going to cover all of that in a blog post. I can, however, find medical problems that need solving (e.g., acute renal failure) and propose drugs/molecular targets to improve outcomes (e.g. Hif1a agonists). Literally tens of thousands of people in the U.S. could do it, but very few will do it, and that's the difference, don't you agree?
/r/TheRedPill30/03/15 01:51 AM
0

http://www.amazon.com/Bang-Roosh-V/dp/1438214235/ref=sr_1_1?s=books&ie=UTF8&qid=1427672080&sr=1-1&keywords=roosh+v+bang
/r/TheRedPill29/03/15 11:35 PM
1

Justice does not exist in this world.
/r/TheRedPill29/03/15 10:08 PM
6

It's adults, not children, who are making up false drunk-rape stories Lying to stay out of trouble. and stealing children from their fathers. Lack of appreciation of consequences. Those seem like pretty childish actions to me.
/r/TheRedPill29/03/15 10:06 PM
3

In your situation, I am willing to accept that is the case. It certainly makes sense in the context of my (very) limited interactions with HNWIs. For most men, however, marriage is provably a bad idea.
/r/TheRedPill29/03/15 09:59 PM
10

That's the one way to get rich that always works -- selling people ideas to get rich.
/r/TheRedPill29/03/15 09:37 PM
1

You are correct based on my experience. I was downsized in '99, after the dot-bombs. This expansion is slower and perhaps more sustainable, but then again, perhaps not.
/r/TheRedPill29/03/15 09:36 PM
2

In many cases, I might believe you. Not in hers. She is personally vindictive even to the detriment of her own writing. That thin skin she mentioned is a fucking fact that many even innocent bystanders have experienced. She is an addled old twat too impressed with herself to ever stop sniffing her own ass-gas (https://www.youtube.com/watch?v=TMTkedIUX8U).
/r/TheRedPill29/03/15 09:33 PM
4

She was banging Michael Douglas for a minute, IIRC. Once you got some movie-star dick, no other dick is ever going to be good enough.
/r/TheRedPill29/03/15 09:29 PM
6

I've dated two doctors. Both were remarkably insecure, which led to relentless shit-testing. Neither were particularly attractive, even by my own forgiving standards, but never in the least bit grateful for anything I did for them. Women who think that they are accomplished are just too much trouble.
/r/TheRedPill29/03/15 09:27 PM
10

They control the sex, but we control the commitment.
/r/TheRedPill29/03/15 09:10 PM
8

They are all crazy. They. Are. All. Crazy. An often-used definition of crazy is doing the same thing over and over and expecting a different result. That's what they do. That's what they do their whole 20's into their 30's, and then, lo and behold, only sub-optimal mates are left. Whoops. Too much crazy. The tats and piercings aren't the sign of crazy, they are just the visible manifestation of the raging insecurity that parasitizes 99.9% of women out there. (The non-insecure ones are the really…
/r/TheRedPill29/03/15 09:06 PM
7

No, dude, just no. You are starting from the premise that marriage is good and right, and finding data to support your conclusion. Totally backwards. From a scientific perspective, you have to disprove the negative hypothesis, i.e., disprove the hypothesis that "Marriage is disadvantageous to a male," and if you can disprove it then marriage might be okay. The thing is, you can't disprove that negative. Quite the contrary. Look, entertain the thought that maybe, just maybe, marriage is not desig…
/r/TheRedPill29/03/15 08:59 PM
9

Fuck bitches and brats... I'm jumping straight to dogs.
/r/TheRedPill29/03/15 08:54 PM
13

You'd think so, but I don't. I sense an earnestness in her replies, places where she could have gone more extreme for more of a reaction but didn't. The hamster is strong with this one, but not unrealistically so. I have a different perspective, though, b/c I had a dead bedroom with my ex- and she could hardly give a shit less when I told her how much it was hurting me and threatening our relationship. They really don't see betas as fully human. It beggars the imagination, but it is true.
/r/TheRedPill29/03/15 08:53 PM
47

In a different post the same user talks about how she is "kinda pretty" at her work but under her clothes kids ruined her body and she's covered in scars. She says the compliment she is most grateful for than any other is her husband's hard dick at the end of the day. She was probably HB8 or better and after her looks were taken she had to take a hard look at herself, eventually coming to the correct conclusions. Good for her.
/r/TheRedPill29/03/15 08:47 PM
7

I hope she takes note. [hamster drive engages 110% thrust]
/r/TheRedPill29/03/15 03:21 PM
1

Social obligation. They go to each other's showers because they expect those bitches at their shower, which will be even better, of course.
/r/TheRedPill29/03/15 03:05 PM
2

If a man has a scarcity mentality, and another man threatens "his" mate, he will respond negatively. He still has close friends, until his wife systematically destroys his network, of course.
/r/TheRedPill29/03/15 03:03 PM
1

There is no "girl code" -- just "bitch politics". ~Dante Nero https://www.facebook.com/dantenerocomedian/posts/654736804598333
/r/TheRedPill29/03/15 03:01 PM
1

I cringed for your friend just now.
/r/TheRedPill29/03/15 02:57 PM
1

One of the dudes on Beige Phillip always gives the girls his number as a pre-screen. If she likes you enough, she'll call. If she had Brad Pitt's number... etc.
/r/TheRedPill29/03/15 02:56 PM
1

then established rapport with him with your bros That's a good point, you could've made a new guy contact who could introduce you to new women you wouldn't have met otherwise. With the social proof of his introduction, you're 25% in with his female friends already. I'm going to keep that in mind for my future interactions. Women are just women, they think that we're disposable/interchangeable so we should think the same of them, meanwhile taking full advantage of making a new friend with another…
/r/TheRedPill29/03/15 02:55 PM
1

I disagree (as you no doubt expected). I don't think that he's going for scraps, I think he's going after whatever gives him happiness, and there is nothing more RP than putting yourself first (also Beige Phillip rule #3, I believe). He could try to out-alpha the other dude, but when I've seen this before the new guy (the girls already knew the alpha) always comes across looking like a try-hard and the chicks slam the new guy down hard. This guy walked away from a rapidly deteriorating situation…
/r/TheRedPill29/03/15 02:51 PM
1

I think next-level TRP does. It's a long road, but based on what the advanced guys post, yes, I see that as their endpoint.
/r/TheRedPill29/03/15 02:47 PM
3

Confidence is a big part of alpha, but not all of it. If you are wondering if you are alpha, you are not alpha (not an absolute rule, but I'd say 99%). "Alpha" is basically bullshit anyways. If you have your own frame, who cares what the women think? The baddest dude I know, the one who pulls the most, even that guy doesn't pull a fish in with every cast. It's numbers, it's a hunt, it's a game... just get in it and get what you want from life. If you're worried about alpha or AMOG or whatever th…
/r/TheRedPill29/03/15 02:46 PM
1

No, bad idea. You have to let him go.
/r/TheRedPill29/03/15 02:36 PM
1

We wish we could, but it doesn't work. He'll have to figure out he lost the game before he understands that he doesn't know the rules.
/r/TheRedPill29/03/15 02:35 PM
4

Or did you start with a vague but insistent feeling that something was undeniably fucked up, and that eventually led you to seek out answers, which brought you down the path that led here? So fucking true. I got here by looking for a book someone else was making fun of, a book on how to please your wife by being more assertive/dominant. I was looking for a way to make her happy, when the truth is that all I ever had to do is make myself happy. There's a 50/50 chance to lose your marriage when yo…
/r/TheRedPill29/03/15 02:33 PM
1

You are speaking of spectra of appearance and confidence, whereas the previous poster spoke of absolutes. You guys need to remember that Tinder is not the world, by the way.
/r/TheRedPill29/03/15 02:17 PM
1

I'm not saying that confidence isn't important. I'm not saying that Game is unimportant. But you guys make this dichotomy where looks are unimportant I structured no such dichotomy. You read what you thought I said, not what I said.
/r/TheRedPill27/03/15 10:52 PM
12

Ok. Now dress yourself in a McDonald's uniform, preferably greasy, force yourself to slouch and don't make any eye contact, and see how far you get. Even with your 6'4" whatever. You don't appreciate what to you has always been invisible because it's part of your nature. It's like skin color -- whites never think it's an issue because it's never been an issue for them. Broaden your perspective. P.S. - of course men hamster. This isn't my issue, though -- I just take issue with your absolutism.
/r/TheRedPill27/03/15 10:50 PM
1

That was so awkward and horrible. She needs practice.
/r/TheRedPill27/03/15 10:32 PM
9

"Just be confident bro, youll get the girl" Interesting straw man you have there. Falls over pretty easily, too. Notice what I said, about how looks are part of overall appearance? Doesn't really match your straw man there, does it? Almost like I had a valid point that you brushed past in order to defend your absolutist point which has a kernel of truth, but does not encompass it all. Tinder is not society. Certainly appearance is important, but if it is all that matters then hot McDonald's work…
/r/TheRedPill27/03/15 10:27 PM
1

He has greatness. She is a comedian (comedienne) and can appreciate that about him. As Beige Phillip says, "Women don't want to win, they want a winner." (Apparently that was originally a Black Phillip principle, which Dante Nero is helping to evolve with Beige Phillip.)
/r/TheRedPill27/03/15 09:05 PM
0

TRP makes no judgments. The caricature is the one you've constructed for yourself.
/r/TheRedPill27/03/15 09:04 PM
5

Looks matter the most no matter how you try to rationalize it away Incorrect. Confidence matters the most, all else is secondary. There are plenty of pretty losers out there. Yes, people judge you instantly on your looks, but that's only part of your appearance. People judge you based on your whole presentation: your bearing, your mannerisms, your dress and even your eye movements. The unique shape of your facial features is only a small part of it. There are better-looking men than George Cloon…
/r/TheRedPill27/03/15 09:01 PM
2

TRP remains amoral, but you have ethics, which is a good thing. You have no right to judge your fellow men, however, and honestly it's not your business.
/r/TheRedPill23/03/15 07:21 PM
1

Google "Beige Phillip brackish bitch". It's mainly for drama-addicted women, but all women need it to a certain extent. Dante Nero explains it well.
/r/TheRedPill23/03/15 07:19 PM
2

Beige Phillip has a bunch of material on this, if you can google up "brackish bitch". She is woman who thrives on drama, so sometimes you have to invent it just to keep her happy. In my case I had to check her by reminding her non-verbally what it would be like not having me around, while simultaneously giving her a shot of reality regarding our respective levels of romantic options. Women think that their pussies are platinum, while the truth is that they are pretty much interchangeable, and sh…
/r/TheRedPill23/03/15 07:16 PM
1

White knighting? You should know better.
/r/TheRedPill23/03/15 07:08 PM
8

At some point I assume I will 1) get used to it, 2) find someone with whom it is not necessary/frequent, or 3) quit attempting relationships.
/r/TheRedPill23/03/15 02:45 AM
6

TRP is amoral. No morals? No hypocrisy.
/r/TheRedPill23/03/15 02:30 AM
46

It's the sunk-cost fallacy. He knows it's over, she knows it's over... it's all over but the paperwork. He's getting off easy -- no lawyer in the world could get a woman alimony after two weeks. If she's not preggers he dodged a 50 caliber bullet here.
/r/TheRedPill23/03/15 02:19 AM
-7

I really need to copy-paste this I say it so much: The plural of anecdote is not data. Also, if you're female, TITS or GTFO. Everything is not about you all the time, you insufferable narcissistic twat. You are not special, you have no status other than your body parts, and therefore you have nothing to offer here. Be smart, be original, be interesting, or begone. If you're male... just try to contribute more in your posts. It's okay, you're still learning.
/r/TheRedPill23/03/15 02:08 AM
26

She's still disrespecting you in public. I would not be cool with that, personally.
/r/TheRedPill23/03/15 01:57 AM
7

It's been one year since I found TRP. Anger has faded, harder lessons still settling in. YMMV. Good luck, sir.
/r/TheRedPill23/03/15 01:44 AM
20

You have to ... have a fucking place where you shit in her mind just to get her to act right The first time I did this, the very first time I did this deliberately, on purpose, just to get what I wanted... I felt like a bitch. Like a manipulative cunt scheming to get my way. It was not a good feeling. I don't enjoy doing it, but it is necessary. It makes me love her less every time I do it, which insanely causes her to love me more when she senses it. Why does it work? Intellectually it makes se…
/r/TheRedPill23/03/15 01:39 AM
26

In my experience there seems to be one exception to the female allergy to male weakness: if she can derive sympathy/social support from it, and if abandoning her male would bring her societal shame. A wife abandoning her husband and the father of her child because he has a brain tumor would be universally derided as a sorry piece of shit; even women have a limit to self-justification.
/r/TheRedPill23/03/15 01:28 AM
5

There are some women who haven't had sexual experience. They may all pretend to be innocent, but remember that at one point, it was actually true. Funny that you called me "kid".
/r/TheRedPill22/02/15 10:31 PM
7

2c. She's shy and inexperienced. 2d. You came close, but your game slipped a bit -- good enough for a 2nd date, not good enough for a 1st date fuck.
/r/TheRedPill22/02/15 12:36 AM
7

I was wondering why my 28 y.o. girl was shit-testing me so much, if she's got the wall in her vision that explains a lot. Thanks.
/r/TheRedPill22/02/15 12:35 AM
13

We speak in generalizations to advance the dialogue. Your personal pique has nothing to do with anything. Most women would prefer a safer, easier world. (So would many men.) It is up to a strong man to make her world safer and easier. Ergo, the man is the protector and director. Also: tits or GTFO.
/r/TheRedPill22/02/15 12:22 AM
1

You are welcome. You understand what I meant, my intent, and that it doesn't apply to you. Cheers!
/r/TheRedPill21/02/15 01:53 PM
1

I just literally laughed out loud. Good one, sir!
/r/TheRedPill21/02/15 01:52 PM
17

And... then dump her after you get your FFM. But, TBH, if she's gotten to that point, she either has or will soon bang some other dude. Not worth it. Cut ties.
/r/TheRedPill20/02/15 01:43 AM
3

I would think you should invest in a vacation or two, just to figure it out for yourself. The first place you try should be the place you would most likely be able to go to, i.e., if your business/career were more amenable to Korea (lots of Internet) or to Phillipines (cheaper place to live), etc.
/r/TheRedPill20/02/15 01:33 AM
1

There is an age limit, and it can be expensive. Talk to a doctor.
/r/TheRedPill20/02/15 01:32 AM
6

Viral STIs are just skin infections. There are obvious exceptions (HIV and hepatitis come to mind), but living in fear of them is non-sensical. If fear is your reason to avoid sex, that is not an admirable way to live your life.
/r/TheRedPill20/02/15 01:31 AM
1

It's not what I think that matters, it's what they think. Many Jews feel they are prejudiced against by ones they would call 'white'. It's really up to them, I have no issue either way.
/r/TheRedPill19/01/15 03:04 AM
0

Condoms give less sensation. I'm still shopping around for right mix of fit and sensation. I use them every single time, though.
/r/TheRedPill18/01/15 05:39 PM
3

Sidebar. You're not here to be spoon-fed.
/r/TheRedPill18/01/15 05:38 PM
3

If you mean "vengeance", then I agree wholeheartedly.
/r/TheRedPill18/01/15 05:37 PM
9

This comment was directed at one woman in particular. You see, in English, words have what are called "plurals", which means more than one. Woman has an irregular plural, "women", which implies at least two but as many as all of them (billions). If we are accused of hating "women" as opposed to "woman", well, this comment is not evidence of that. P.S. who gives a shit about what "they" think?
/r/TheRedPill18/01/15 05:35 PM
2

Downvotes do not generally reflect the idea expressed so much as the way they are expressed. For instance, if expressed in terms of "fuck that guy, you don't know him" vs. "men won't thank you for telling them negative shit about the girl they're fucking", then that makes a difference. Not that downvotes matter much, but you did mention it.
/r/TheRedPill18/01/15 05:32 PM
1

Don't know why you bothered with the little moralistic coda at the end. Because things you get by tainted means sometimes feel tainted. Because the child might at some point in the future want to know who his/her mother was. Because actions have consequences. Because ends don't necessarily justify means. Some people have an easier time living with certain things than other people.
/r/TheRedPill18/01/15 05:19 PM
3

Just tell them you're accepting monetary donations towards your surgery, but if they are oppressive shitlords you understand why they would rather have their dirty money than a happy coworker.
/r/TheRedPill17/01/15 08:00 PM
4

Fission and Fusion? White Dudes. Jewish, really, but I don't know if they count themselves as white or not. They don't qualify for diversity funds, though, so the point is still apt.
/r/TheRedPill17/01/15 07:57 PM
10

Narcissistic weirdos that want to stamp their personality into a little kid for the ego-trip and/or perverts. You've got one hell of a blind spot. Good luck with that.
/r/TheRedPill17/01/15 07:50 PM
6

I am adopted. It's not the same.
/r/TheRedPill17/01/15 07:48 PM
2

You begin to enter the Dark Side when you start thinking about conceiving abroad. If one were to have a child in a Muslim country (Africa, ME, SE Asia) then that child belongs to the father. Divorce the mother, instant custody. File paperwork to bring child back to U.S. (or wherever you're from). At a later date mother might file some paperwork to try to get standing in a U.S. court, but if there are allegations of abuse (ginned-up or otherwise) in the home country, U.S. judges won't want to tou…
/r/TheRedPill17/01/15 07:46 PM
57

They can't because it's an oblique attack on gay men, and they would get curbstomped by the rest of the left-politics coalition. (They have little stake in this, gay men have major stake, etc.)
/r/TheRedPill17/01/15 07:41 PM
3

From the context, the sister-in-law probably also played a role. Bad influences, etc.
/r/TheRedPill17/01/15 07:38 PM
7

And chicks will defend strangers over their own brother. Chicks will defend women over their brother, but usually not a woman. I.e. they can hamster tearing one obnoxious bitch down, but only if it doesn't damage the woman-brand.
/r/TheRedPill17/01/15 07:36 PM
2

If sis-in-law can save herself by drowning the other bitch... sorry 'boutcha!
/r/TheRedPill17/01/15 07:35 PM
3

servile (adequate word for it? It is an excellent word used in the perfect context here.
/r/TheRedPill17/01/15 07:34 PM
3

It's not what YOU think is bluepill, or I think is bluepill; it's what SHE thinks is bluepill. If you don't know that, you don't know shit.
/r/TheRedPill17/01/15 07:33 PM
14

Going against her: 1) no kids 2) she cheated 3) no kids 4) pre-nup 5) no kids 6-10) his lawyer 11) see #1 She'll get support for a while, and some assets, but she's not walking away with cash and prizes because she hasn't got any fuck trophies.
/r/TheRedPill17/01/15 07:31 PM
6

If there are no kids the ground is much more even.
/r/TheRedPill17/01/15 07:29 PM
15

They met at 22, been together 8 years... so she is wall territory.
/r/TheRedPill17/01/15 07:28 PM
3

He did what he had to do and found a good lawyer pronto. Shit will not be perfect for him, but it will be as good as it can be.
/r/TheRedPill17/01/15 07:27 PM
6

That strawman never stood a chance! You really showed him... What's your next great feat? Are you going to make water flow downhill? Or the sun set in the west? I can't wait to see which impossible task you choose next.
/r/TheRedPill17/01/15 07:26 PM
1

I don't understand you. I understand what you said, but not you. Whatever works, though!
/r/TheRedPill16/01/15 12:17 AM
5

No, but if you were become disabled somehow prior to the divorce, it would reduce your future earnings. I saw a guy at a health clinic once who "recovered" from schizophrenia. Crazy, I know. Defrauding Social Services (or whoever pays disability payments) is a crime, and I would never advocate a crime, but if no disability papers were filed then no crime would have been committed. wink-wink
/r/TheRedPill15/01/15 03:13 AM
13

Because unicorns don't exist Yes they do, they just aren't what we expect. http://media.tumblr.com/b93bdbdaeeac1f410d1583f85becaef5/tumblr_inline_n4namhX2wO1rlded0.jpg They are attracted to virgins, though (the only kind of guy they can reliably get).
/r/TheRedPill15/01/15 03:07 AM
2

You're not wrong, why dim your star for the sake of some dumbshits? Absolutely within your rights. You will suffer for being right, but, hey, if you understand that going in, you won't be surprised when life dings up that shiny armor you're riding around in. Best of luck, maybe it won't happen to you, but... best of luck.
/r/TheRedPill15/01/15 02:52 AM
2

Why risk your business for some tail? That's fuckin' stupid. Abundance mentality.
/r/TheRedPill15/01/15 02:51 AM
0

What flavor? I mean, in your magical little fantasy land, where unicorns fart cotton candy and leprechauns shit ice cream, what flavor is the ice cream?
/r/TheRedPill15/01/15 02:50 AM
1

I don't know why people pay for McDonald's food. One time I went in there and they were about to close and they just handed me a huge thing of fries and three apple pies, just because I ordered a drink. (See how useful that anecdote is? That's what you just did.)
/r/TheRedPill15/01/15 02:49 AM
2

You have to read this stuff with the following in mind: why are they saying this? And the answer is... they are bitch-shaming. They are letting women know that it's okay to criticize their women co-workers. No woman will read this and say, "Oh, I do that too." They will read it and say, "Fuckin' Sheila." This is not them admitting their nature (something they will never do), it is giving them cover for the way they already feel. Remember: women suffocate in a validation vaccuum, even if that val…
/r/TheRedPill15/01/15 02:47 AM
1

The good news is that restaurant jobs are plentiful. Out one place? You can have another job inside a week if you work your connections. So, keep those connections.
/r/TheRedPill15/01/15 02:33 AM
6

When is HR ever not useless? Fireworks, jackhammers and women make noise... just gotta suck it up.
/r/TheRedPill15/01/15 02:31 AM
1

It's about the frame. When they propose this kind of thing they are pulling you in, and you have to resist that. When asked for input it's a good time to try the ol' flip-the-script; "I see both plusses and minuses, but I'd like to hear more about what you think." Never, ever elucidate on your amorphous and completely bullshit plusses-and-minuses, because that puts you on one side or the other. Mentally check out and think about some other shit -- whether to get that radiator new or take a shot …
/r/TheRedPill15/01/15 02:30 AM
3

Happened to me... twice. Man, I'm a fuckin' idiot.
/r/TheRedPill15/01/15 02:25 AM
1

Every woman has that one bitch at work she can't stand. Every. Single. One. Chris Rock even has a bit about it. There is no such thing as "drama-free". The only time women stick together is when they feel like they are being attacked for being female, or if there is a strong patriarchal presence to keep them in line. Don't just believe me -- watch "reality television". Yes, it's scripted, but it is designed to bring out what it naturally there and make it obvious for the 'Mericans at home on the…
/r/TheRedPill15/01/15 02:18 AM
1

Agreed. This shit could easily go thermonuclear. But there's no changing it now... might as well ride it out and hope for the best.
/r/TheRedPill15/01/15 02:13 AM
1

It might seem to be a sign of aging, with lighter skin seeming to be younger, and younger seeming to be more fertile. Just a thought.
/r/TheRedPill14/01/15 04:51 AM
3

I was in Ft Wayne for about a month. Can confirm it is an easy place to find average-looking women. As for the better-looking women coming to Indianapolis... they often go to Bloomington (Indiana University) first.
/r/GEOTRP12/01/15 09:05 PM
1

True. But if a non-religious girl has not had many partners, she is probably nerdish/socially awkward, which is its own issue.
/r/TheRedPill12/01/15 08:57 PM
13

"From a biological success standpoint"... that's the critical part you may have missed.
/r/TheRedPill11/01/15 08:13 AM
15

Man you guys are hateful here Some are. Hopefully it is a phase for most and they come to realize that this is merely the way things have always been, and that they were deceived because they allowed themselves to be deceived. Most grow out of it.
/r/TheRedPill11/01/15 08:12 AM
10

I would say 95% or more, which makes your statement essentially true. There are some who through nerdiness or virtue have had less experience and may not be widows. They are infrequent and may have a slew of other associated problems (particularly prudishness or awkwardness), but non-widowed women do exist to be found.
/r/TheRedPill11/01/15 08:10 AM
7

Giving a guy shit for being sad when his elderly father is in the hospital isn't human. She's a shitball. You did say plate her, though, and I think we all agree with that.
/r/TheRedPill05/01/15 03:25 AM
41

There are few times you are allowed to seek comfort. That was one. She failed. She is not LTR material.
/r/TheRedPill05/01/15 03:24 AM
1

Boned. Only other way I can see it is if you are legally married to someone else... Weird, I know, but there are situations where it could happen and be alright.
/r/TheRedPill03/01/15 07:39 AM
2

You can live with her, just have your own place on the side. Stay there now and then, get mail there, etc. If it's a trailer out in the countryside it might be affordable. Just spitballin', legal formalities, etc.
/r/TheRedPill01/01/15 03:57 AM
5

Is a surrogate an option? Also, if you don't live with the woman, but maintain your own separate residence, does that prevent the common law marriage?
/r/TheRedPill30/12/14 10:50 PM
1

That's not intelligent, that's just insane. Ah, not intelligent then. If you were, you would know that insanity and intelligence run in the same families, and in many interesting ways, can be considered the same thing. Well, have a fun life I guess. Goodbye.
/r/TheRedPill21/12/14 02:34 PM
3

If you were Brad Pitt, she'd figure it out. When in doubt, apply the Brad Pitt rule.
/r/TheRedPill19/12/14 02:50 AM
1

Seek help, because you're heavily projecting your self-hatred onto me. You know nothing about people. Even on the Internet. Being too intelligent has always alienated me from others, so either you're more intelligent than me, or a hell of a lot less.
/r/TheRedPill19/12/14 02:32 AM
1

You need to find and make friends with a club promoter if you want to do the nightclub shit. If you are the type who can afford bottle service etc. it will open doors for you. Unfortunately, if your game is shit, the chicks will drink your booze and fuck other dudes at the end of the night. You succeeded in one field already; it will take time and effort to succeed in another. Not that I know from personal experience, just from logic and watching some of RSD's other videos.
/r/TheRedPill18/12/14 02:43 AM
2

I'd go with chaistudios' option... hard next, nopenopenopenope your way out of there. Terrible judgment on her part.
/r/TheRedPill18/12/14 02:19 AM
1

be careful of going full beta ♂ I've been paying for all the dates. I need to cut that shit out. I only paid half the bill last time and she wasn't too happy about that. I consider it a bad sign.
/r/askTRP17/12/14 11:22 PM
1

♂ Thanks. She sometimes says it laughing, sometimes pouting. I wonder if the pouting is a shit test. Oh well, I'm having fun anyways.
/r/askTRP17/12/14 11:21 PM
1

I don't like the term "butt-hurt". It's not descriptive enough. Bitter remorse captures it more clearly. Near-suicidal depression. Financial ruin. Lost years and opportunities and friendships and even pets. Everything you wanted or thought you wanted, pulled apart in front of your eyes. Butt-hurt does not fucking cover it. I hope you never find out.
/r/TheRedPill17/12/14 11:18 PM
1

Marriage is a shitty decision.
/r/TheRedPill17/12/14 11:16 PM
1

The thing is, it's not random chance who is going to get divorced. You know who gets divorced? Whores and betas. My first and last exes were whores, but I was always a beta, always a Mr. Nice Guy. I'm not getting married again because, clearly, I'm not good at it. But I am EMINENTLY qualified to expound upon it, moreso than anyone who has only experienced marital success. If you want to learn about business, you don't only talk to the guy who hit it big on his first try and doesn't know what it'…
/r/TheRedPill17/12/14 11:15 PM
1

And saying that you've failed at marriage 3 times qualifies you as an expert on marriage as well? Fuck yes it does. Hamsters gonna hamst.
/r/TheRedPill17/12/14 11:10 PM
1

"A mouth's a mouth!" http://www.cc.com/video-clips/3cv2kt/chappelle-s-show-dudes--night-out---uncensored
/r/TheRedPill17/12/14 02:05 AM
1

Some girls in the U.S. use Tinder for that as well. They can tell which guys are orbiters/dates pretty quickly. They know what they are there for, though... can't blame 'em for picking up an orbiter who's on sale, though.
/r/TheRedPill17/12/14 02:04 AM
2

I think a few people missed your joke there, but you cracked me the fuck up!
/r/TheRedPill17/12/14 02:01 AM
1

Our job has a high rotation through-put (not people getting fired, just rotated to different responsibility areas). Our previous team had a 2nd-in-command male and a 3rd-in-command male who were both rotating away and being replaced by females. In fact, only the 1st-in-command and the pond scum (me and a peer) are now males. Before the other two males left, a female rued that she was losing the "guys", and it was turning into essentially an all-female team. (Nevermind the pond scum.) There is so…
/r/TheRedPill17/12/14 01:52 AM
2

What's the deal with her dad? Oh, wait, nevermind. I think I know.
/r/TheRedPill17/12/14 01:47 AM
3

So you made it down to #10? You have a high pain tolerance.
/r/TheRedPill17/12/14 01:46 AM
2

The bitch thusly described is totally un-dateable. Probably un-fuckable, too.
/r/TheRedPill17/12/14 01:43 AM
3

NARALT, eh? We speak in generalizations, Clown, not in your magical faerie land where starlight pandas diarrhea-poop ice cream directly down your gullet. In the real-fucking-world(TM) marriage is fucking useless, and has absolutely no advantage over cohabitation and does have several significant potential downsides. If it worked for you then whoopty-fuckin'-doo, but don't go telling the young men that everything will be alright for them too. They get plenty of sunshine from the sun, thank you, w…
/r/TheRedPill17/12/14 01:39 AM
3

I've been married three times, and he knows all he needs to fucking know. You're attacking his credentials, not his logic, so your shit is weak. Check your feelings, young Skywalker, because you are trying to shield your ego by using hamster logic.
/r/TheRedPill17/12/14 01:35 AM
3

Your loss, motherfucker. It's a good post.
/r/TheRedPill17/12/14 01:33 AM
-17

Don't worry, the detectives would sniff that shit out in a heartbeat. They would get her on record, filing a statement, then charge her with filing a false statement. DA wouldn't prosecute, but boyfriend is open to file civil charges for damages. It's not justice, but it would fuck her life up for about a year or so.
/r/TheRedPill14/12/14 03:34 AM
1

I don't doubt that. The natural state is to desire sex. Like the great Patrice said, though, at 40 you change and your horniness is less.
/r/TheRedPill13/12/14 02:18 PM
1

Sometimes experiments fail. Good luck and godspeed, sir.
/r/TheRedPill13/12/14 02:17 PM
10

It's not a bad idea to not offend people at work. I.e., if you are a worker bee, best to not upset the queen. If you are a worker bee, then you need to be working your ass to get out of there, though.
/r/TheRedPill11/12/14 02:51 AM
1

Maybe I'm truly sad, but I don't really want sex. It's messy and complicated... even if it seems easy at first, it always leaves a residue or miasma or something. Sex is just sex, what's so awesome about that?
/r/TheRedPill11/12/14 02:34 AM
0

They are good snark, bitches love snark. I think the 2nd one is worst for texting, but the 3rd one might be okay... except it is too long. Texting should be primarily for meeting up, though. Texts are too easily misinterpreted.
/r/TheRedPill10/12/14 12:45 AM
1

Ex-wife was 9 for 19. Never saw the signs, never had a doubt. Bluepillers just don't want to know...
/r/TheRedPill10/12/14 12:30 AM
1

My SMV is already high and going higher. So much so that I haven't met any women recently that deserve me. I'm not being egotistical -- it's just they do not have admirable qualities. I'm sure there are some -- the proverbial needle in a haystack or gold in a shitpile -- I'm just not of a mind to go digging.
/r/TheRedPill09/12/14 12:31 AM
1

The more intelligent one is, the more difficult it is to find an equivalently intelligent partner. Example: my above-average intelligence former co-worker was in the grocery store with his girlfriend. They were gathering ingredients to make hot wings. She told him the next item in the recipe was Kenyan pepper. He asked her to repeat it a couple of times. Kenyan pepper. Kenyan pepper. He took the list and read it himself. Cayenne. He cut it off with her the next day.
/r/TheRedPill08/12/14 02:07 AM
3

That's what everyone hopes. Hell, it might be what everyone thinks, even women. They don't want to leave you, to fall out of love with you, to lose their security and reputation... but in the end AWALT. The best marriage thermometer I know is blowjobs. If she is not sucking your dick on the reg, then the fuse is burning on that bomb and shit is going to get real sooner or later. Step up the dread.
/r/TheRedPill08/12/14 02:05 AM
8

You could buy all the pussy you want but it's never going to feel as good as a pussy that chose YOU. This is a hard truth to accept, but it's true for many men. It's next-level RP to derive your worth from yourself and not from external validation. As for the downvotes; there are some unpopular truths even here.
/r/TheRedPill08/12/14 01:59 AM
6

But really, honestly, what does a woman bring to a man's life? Drama... no doubt. Sex... maybe, if you know what you're doing. You can buy sex, and rent drama at Redbox. What does she really really give you? Women make life more comfortable, but comfort makes you weak. Women can serve you -- cook, clean, etc -- but once again a maid and cook won't cost you half of everything. There is nothing you desire -- including children -- that you can not obtain via financial exchange.
/r/TheRedPill08/12/14 01:44 AM
2

Thanks for the post, this is good stuff, upvoted for visibility... but your interpretation of it would also be good.
/r/TheRedPill07/12/14 04:29 PM
12

Agreed. The key to drawing out this information is to be non-judgmental. Women love to talk (it's how they feel intimate and it increases their comfort) and if they think you will not judge them they will tell you the truth for two reasons: 1) it feeds their hamster because if you don't judge them, it must not be that bad, and 2) it gives them an aura of pre-selection (which they think is valuable but we could give a fuck).
/r/TheRedPill07/12/14 04:26 PM
2

I repeat myself: anecdotes are not data. And I don't want to share examples from my life, not that I'm ashamed of them, but I prefer not to give future potential doxxers any fodder. http://lmgtfy.com/?q=convictions+of+women+and+men+for+the+same+crime edit:words
/r/TheRedPill07/12/14 04:14 PM
3

And people say this sub isn't sexist. Anyone who says that is a fucking idiot. This sub acknowledges that the sexes are different, what could be more sexist than that? It is feminism that pretends to not be sexist when in reality it is all about sexual superiority for women. You can't expect much better, though, because it's weak men that allow women to think that they are in the right when empirical evidence says otherwise. Oh, and TITS OR GTFO.
/r/TheRedPill07/12/14 04:07 PM
1

The plural of anecdote is not data. I could give you data, but data is not persuasive to women. Tits or GTFO.
/r/TheRedPill07/12/14 04:04 PM
35

It's like looking for gold in a shitpile. Is it worth it to look? (I'm pretty bitter right now though.)
/r/TheRedPill07/12/14 03:58 PM
3

You are 100% correct of course. Replication by other, independent experimenters will be required, and even then it's not "proof".
/r/TheRedPill07/12/14 12:37 AM
12

Your comment is amusing... but not all the cells in your brain are used for thinking.
/r/TheRedPill07/12/14 12:36 AM
4

It's all about sensitivity and specificity. A sensitive test detects all true positives, a specific test rules out all false negatives. With a rate of 8-10% in the least sensitive categories, this would be a shit test. With the other potential causes (pregnancy, miscarriage, and even sex) it would have shit specificity. Breakdown: nah, shit test. Until one could differentiate between males in the microchimerism this test is completely impractical.
/r/TheRedPill07/12/14 12:35 AM
9

This is why you shouldn't "date". If it's not a "date" then the expectations are less. Don't give them the satisfaction/status of it being an acknowledged "date"... just do the old "hang out", "get together", or if you're really romantic "spend time". Don't do the "date".
/r/TheRedPill06/12/14 09:19 PM
1

They didn't get his money. He won.
/r/TheRedPill06/12/14 09:09 PM
2

It is important to note that aggressive opens do not always work. He is only showing the ones that do. No big deal, find the next chick. That said, the weakling-waffling-nice-guy openings pretty much never work.
/r/TheRedPill06/12/14 09:08 PM
2

Oh, too good not to use. Especially in a bar.
/r/TheRedPill06/12/14 09:06 PM
2

Not at work. Don't fuckin' do it... don't shit where you eat.
/r/TheRedPill06/12/14 08:54 PM
4

Evidence tells you what; the rationale tells you why.
/r/TheRedPill06/12/14 08:52 PM
4

If you are pre-selected by other women, then you fuck the chick, she can claim equality or even supremacy to them in attractiveness. They know they can't be fucked into being a supermodel, but they also consider attractiveness to be a whole package, the same way we consider attractiveness to be visual (each sex has it's own myopic perspective).
/r/TheRedPill06/12/14 08:52 PM
1

When women get in deep shit, they crave a beta's comfort. Alphas are for adventure/fun, betas are for friendship/comfort. She's feeling terrible because of the shit going down, so she wants comfort. Also, no one is more attractive than the person who rejects you, especially if you offer yourself -- his rejection of her is doubling (or more) her native attraction. If he took her back this "rejection bonus attraction" would fade away like a fart in the wind. https://www.youtube.com/watch?v=xPlavnc…
/r/TheRedPill04/12/14 09:11 PM
1

Anger/bitterness/sadness... all part of the pill. That's why so many men refuse to take it.
/r/TheRedPill01/12/14 11:12 PM
1

I'm not going to get married.
/r/TheRedPill01/12/14 11:05 PM
1

Wrong. Tell her UP FRONT, before you are even married, and stand your ground. Never be afraid to lose her. If she doesn't like it, next her. I prefer to let her hamster do its thing.
/r/TheRedPill01/12/14 10:39 PM
9

It is much more difficult in practice. It's easy to be RP to unattractive women, but when there's one I have a shot with it takes a lot more awareness of the situation. I still fail. I still have a lot to learn. But I'm doing a hell of a lot better than I did as a BP. It has been the execution that has made all the difference in the understanding.
/r/TheRedPill01/12/14 10:36 PM
1

Nope. That's my beer fridge. The door is behind me.
/r/TheRedPill01/12/14 10:23 PM
1

These things that women find attractive are just their cavewoman instincts suggesting as to what is valuable in a male, i.e., a best guess at his genes.
/r/TheRedPill01/12/14 10:22 PM
1

Fair enough, good answer, go for it.
/r/TheRedPill01/12/14 04:06 AM
1

Recent research suggests that this is not the case. You should familiarize yourself with the literature; I suggest starting with the work of Robert Lustig. https://www.youtube.com/watch?v=dBnniua6-oM
/r/TheRedPill01/12/14 04:03 AM
7

Scientists say: the more abstruse the terminology, the greater the obfuscation. (Big words = bull shit) edit: there is some weird downvoting going on in this thread. Strange.
/r/TheRedPill01/12/14 04:00 AM
1

Why fake it? Actually do it, and it will be that much more effective.
/r/TheRedPill01/12/14 03:56 AM
1

That is your choice. If you value pussy above all else, then yes. Remember though that he is broke, a felon, and has no lasting friendships or relationships. He does get tons of pootie, and the girls (or guys) do what he wants them to do. If that is your highest value, then emulate him.
/r/TheRedPill01/12/14 03:52 AM
3

I have better things to do than to educate morons. The context is clear. Fuck you if you think anyone owes you anything vis-a-vis making it easier for you. Subject closed.
/r/TheRedPill01/12/14 03:50 AM
2

If I was dumb enough to buy her a ring, and you -- my friend -- fuck her, then fuck you. You can't justify your way out of that. Period. End of story.
/r/TheRedPill30/11/14 08:59 PM
1

True, perhaps, but the Internet is for information. Each individual decides what to do with each piece of information, whether to keep it, discard it, or modify it to their unique situation.
/r/TheRedPill30/11/14 07:28 PM
2

This is an excellent discussion. I will consider it seriously. Thank you for taking the time to help others with their education.
/r/TheRedPill30/11/14 07:23 PM
1

He gets laid every night he goes out. Every. Goddamn. Time. The dude is 5'6" and went bald at 25. He's broke, he's a felon, he lives at home with his dad, and he gets ass like it's being handed out for free. Married, dating, single; whores, angels (well, relatively speaking), in-betweens; all races, ages usually younger than him, and even occasionally guys (I'm not judging him for that -- he can do what he wants). He's a poon-tang rockstar despite his looks, height and how broke he is. Anyone wh…
/r/TheRedPill30/11/14 07:18 PM
2

It comes down to respect: if a guy I know fucks a woman he knows he isn't supposed to be fucking because I've claimed her, then he has demonstrated himself to be untrustworthy. He valued pussy more than my friendship. If he is selfish in one regard, he is selfish in all regards, and can kindly go fuck himself.
/r/TheRedPill30/11/14 07:12 PM
2

Luckily I'm in the UK so getting shot isn't really that much of a risk I'm in Indiana, so, yes, it is a risk. Not as much as in Texas, but still a risk.
/r/TheRedPill30/11/14 05:06 PM
2

At 16 you are still very young. Your mind might change after you get to college. That's not a girl thing or boy thing... it's a young person thing. If you still want to do it, and if you want a RP husband, you may have to prioritize one over the other. You will not be fully into your career until you are 30 years old. Also, it will change your perspective on which men are attractive to you... i.e, someone with less accomplishment will become invisible to you. That's not a bad thing -- it just sh…
/r/RedPillWomen30/11/14 04:59 PM
2

Women hate when men fight... over anything except her.
/r/TheRedPill30/11/14 04:48 PM
1

Cocktails are also $3 (well) when they are on special.
/r/TheRedPill30/11/14 04:46 PM
5

This won't work as well, because they are naked too. The point is that you are vulnerable. If you are afraid of going to jail, wear a mask. Better yet a full-face motorcycle helmet... those are less suspicious.
/r/TheRedPill30/11/14 04:39 PM
3

Think about what you despise in other men. Look for objective evidence of that in yourself. Honesty is key. If you find it, root it out and kill it. If you do not kill it, ask yourself why not. Examine your failures and try to improve, instead of dwelling in your successes. You don't need to fix what isn't broken.
/r/TheRedPill30/11/14 04:37 PM
0

Maybe more than half. But the evidence I've seen in my life makes me think that there are truths here.
/r/TheRedPill30/11/14 04:33 PM
7

That is so fucked up, this is why women are horrible people. Nah, it's just their biological imperative. Best genes + most support for their offspring = AF + BB. Don't hate a fish for swimming. there is no bro code If a friend fucks my woman (and I have reason to expect her to be faithful) then he done fucked up. If he's not a friend, fine, whatever, he's just the dick she chose to fuck her -- might as well be a human dildo. Betas love the bro code, BTW... anything that they think gives them an …
/r/TheRedPill30/11/14 04:30 PM
12

Disclaimer about angry, jealous husband. Dudes have gotten shot over that shit before. I'm not saying do or don't, just be mindful of the potential consequences. I won't fuck with a married woman.
/r/TheRedPill30/11/14 04:26 PM
10

This. Is. Gold. Thank you, I will use this one if I ever encounter it. Up until now I have just used, "He's not here right now," with a mischievous grin. I like yours better. If she follows up and talks about him again, I assume he's real and/or she doesn't really like me, so I move on.
/r/TheRedPill30/11/14 04:23 PM
11

I don't care whether they are externally originated, I have the morals that I like, and it is my choice to incorporate them. Am I limited by them? Yes. Do I care? Not really. It is a conscious expression of my preference, and therefore it is my right. I'm not judging you because I don't know you, but the most amoral guy I've ever known I would be likely to jack in the face right now just because he is a massive asshole. The choice of rejecting morality also has consequences.
/r/TheRedPill30/11/14 04:20 PM
1

Don't make the mistake of telling them about Red Pill. They have to be ready. You can wingman for them at bars, though. I've found that my crazy success with women compared to someone still in the FemMatrix always gets their attention. Two or three nights out, and they will start to ask questions. That's when you can drop very simple, obvious truths, like women are different than men, and why women like bad boys, etc. You have to go slowly, and if they take the Blue Pill, let them go. DON'T TALK…
/r/TheRedPill30/11/14 04:12 PM
2

Your life will now be transformed. You will observe social situations through a new lens. If you have a LTR right now, it will very likely be either heavily damaged or ended (give it 4-6 months). You will be a new person in 6 months to a year. Unless you slip back into denial of what your eyes have been telling you for years, but you lacked a mental framework to comprehend.
/r/TheRedPill30/11/14 04:09 PM
2

If you have proof that women are not self-interested and biologically programmed to better the species, I'd love to see it.
/r/TheRedPill30/11/14 04:07 PM
5

Emphasize field experience.
/r/TheRedPill30/11/14 04:06 PM
1

She sent an email with six that she liked. I chose the one of those six that I liked the best.
/r/RedPillWomen30/11/14 04:02 PM
3

A zen master takes a lifetime. I did not imply that he was a master now; you inferred it.
/r/TheRedPill30/11/14 03:59 PM
2

Don't you fucking concern troll, dumbass. Who gives a shit what they think? There is nothing you can do to ever win their approval, and just trying makes you look like a pussy.
/r/TheRedPill30/11/14 03:58 PM
2

The first 12 letters of your post annoyed me enough to read nothing else. If it's important, re-write it and re-submit it using adult language.
/r/TheRedPill29/11/14 02:19 PM
34

Unfortunately not everyone will achieve that level. That's why zen masters are masters, and not zen everybody.
/r/TheRedPill29/11/14 02:17 PM
7

Why are you fighting straw men? Who said anything about quality? Of course the majority of any category can't be "quality"... it's damn near a definition in terms. But your false equivalence of quality men and quality women is where your thinking becomes cloudy. What is a quality man? A highly successful achiever, doing great things that no one has ever done before -- Salk and Sabin invented vaccines for polio which saved MILLIONS. OF. LIVES. What's a quality woman? In the sense of improving the…
/r/TheRedPill29/11/14 02:10 PM
12

Now why can't you ever be truly happy with a woman? Because you can never trust her the way that you want. She's not like us. Men are the fairy-tale romantics -- romance was invented by men. Everlasting love is what men want, not women. You can never be happy with a woman BECAUSE of who and what women are. And what they are is fucking fickle.
/r/TheRedPill29/11/14 02:00 PM
1

I was a bit shitty about it at first. I expected a better reaction. In hindsight, I overwhelmed her. I took her to all the places that mattered in our relationship -- our first kiss, our first date, where we said we only wanted to see each other, where we first made love -- and then I proposed to her at the exact space on the sidewalk where she first touched my arm on our first date. It was electric for me. I knelt down (some cars honked at us) and gave her the ring, which was huge and beautiful…
/r/RedPillWomen29/11/14 07:05 AM
8

If you think you'll seem creepy, you can always make up a story about your friends planning to meet you there. Approach a group, talk to some girls. If things go well, text your "friends" that you'll meet up with them later. If things aren't going well, perfect excuse to ditch. This would work better in a place with a few bars in walking distance, so you could move between multiple ones if you want. Going out alone will really build up your game, plus you might actually meet some people worth be…
/r/TheRedPill29/11/14 07:01 AM
53

If you ever forget that her love is conditional, you will lose her. There is a sunk-cost fallacy that will make her stick around longer if she's invested more in you -- she won't abandon her investment quite as rapidly -- but do not be fooled, no woman wants to sign on for your failures. If you live life courageously, accomplishing what you set your hand to, and only allowing women to ride along in the comet-tail of your stellar accomplishments, then you can have a woman for life. When she's too…
/r/TheRedPill29/11/14 06:56 AM
15

Typical burned-out, bitter husk of a former woman. She's bitching about all the fucked-up dudes that she picked for herself, thinking she deserves a fucking Leonardo or Channing Tatum (much truth is said in jest, honey-twat), and yet all the guys who would treat her right -- ask her "what's wrong?" twenty-five fucking times -- all those guys are fucking invisible to her. I almost feel sorry for the bitch... almost.
/r/TheRedPill29/11/14 06:44 AM
23

Even betas get laid sometimes. It's not worth the risk. If she has a lot of guys around all the time, you cannot be certain that she's not fucking or will not fuck one of them at some point. If you're cool with that, then cool, but if you are in a LTR then you should think long and hard about it.
/r/TheRedPill29/11/14 06:29 AM
3

LTRs will always be hard mode, no matter what. Sure, you can do surgery on a horse to implant a horn in its forehead, but that does not make it a unicorn. It's just a goofy-looking horse.
/r/TheRedPill28/11/14 06:30 PM
1

[guy comment here] When I proposed she froze up completely. She couldn't smile or laugh and walked like a wooden mannequin. It was weird. We met my brother and her brother at a bar immediately afterwards, and it took one hard cider and about 45 minutes for her to come out of her coma. If it were to happen to you, then you wouldn't be the first.
/r/RedPillWomen28/11/14 05:16 PM
2

Women have a deep need to feel "authentic". Basically, "authentic" feelz is the best hamster crack in the world. If they are being "authentic", they can justify damned near anything to themselves. The problem comes in when they are not actually authentic, but just lying to themselves, and they secretly start to realize it. Then is when they need to attach themselves to an authentic person and fool the authentic, genuine person that she is authentic too. If he is actually authentic, and he thinks…
/r/TheRedPill26/11/14 11:19 PM
2

Also pretty good at sex, though.
/r/TheRedPill26/11/14 11:13 PM
1

I listen to Beige Phillip fairly regularly. Sometimes it's more about comedy than about sexual politics and game, but I always enjoy it, and if you only talk about one thing all the time it can get boring. It's a bit more than 1 hour per week that I enjoy.
/r/TheRedPill26/11/14 11:10 PM
0

YOU DON'T TALK ABOUT RED PILL. (Sorry for the shouting, but some rules are made to not be broken.)
/r/TheRedPill26/11/14 11:05 PM
6

Krav maga is the only defense type that claims to address multiple assailants, and they say, "Don't." They teach that by using one assailant's body to block the other assailant you can try to eliminate the first one quickly while the second is screened... but they still say you are probably going to get fucked up. The best way to deal with multiple attackers is with a weapon.
/r/TheRedPill26/11/14 02:58 AM
2

Any woman is capable of keeping her legs closed. Even the used up old rent-a-cunt who's had 1,000 men between her knees (and been on her knees for 1,000 more!) would stay pure for that one man. They always have "the one man" that they will truly love in their heart. Even if the reality of that man would disappoint, they still hold his memory as their most cherished dream. He is the Alpha who Widowed them, and he always will be. What are the chances she married her Alpha, and that he stayed Alpha…
/r/TheRedPill25/11/14 11:40 AM
3

When she becomes vulnerable for whatever reason, and she is a little drunk (or a lot drunk) and she needs that extra bit of validation... or if she's vulnerable, and about to lose an orbiter (especially if he's the only one she has), or if he's purplish instead of pure blue... If betas never got sex they would change. The truth is that they do sometimes get sex, just a lot less than if their behavior were different.
/r/TheRedPill25/11/14 11:35 AM
10

Didn't read, no paragraphs. This is a low quality submission.
/r/TheRedPill24/11/14 02:58 AM
2

There are 10,000 reasons not to approach women, but only 1 reason to do so. Which is more important to you?
/r/askTRP11/11/14 02:55 AM
1

Not true! Unicorns do exist!! Here's proof: http://cdn.webfail.com/upl/img/62597dcd9ae/post2.jpg
/r/askTRP11/11/14 02:48 AM
3

EE chicks are not worth it, IMO. They are the most AWALT of "all women".
/r/askTRP11/11/14 02:42 AM
3

She is no fucking unicorn, that's for fucking sure.
/r/askTRP11/11/14 02:41 AM
1

Red flag. She's leaving her crazy all over your dick. Would you accept that behavior on a first date? Maybe a good LTR gets one pass... ONE... but this is a pattern. Evaluate your options. It hurts to end an LTR, but sometimes it just has to happen.
/r/askTRP11/11/14 02:39 AM
2

This sounds like flirting, not a shit test. Flirt back, tell her you will rip it off of her body. That is pure tingles right there.
/r/askTRP11/11/14 02:34 AM
1

You will get more help in AskTRP
/r/TheRedPill11/11/14 02:14 AM
1

The anger passes. You might/probably will still question whether women are worth it.
/r/TheRedPill11/11/14 12:24 AM
1

I benefited financially, but paid a price in time. A heavy price.
/r/TheRedPill10/11/14 04:02 AM
6

If you are asked out because you are perceived as a beta provider, you should worry. NO, no you shouldn't. They are approaching you. If you assume a sexual frame, and they enter it, then you won. If they don't enter it, what did you lose? Remember: the woman's ideal is actually AF/BB in one man. That is their ideal. They would love to actually want to fuck their BBs. They would think that was the best thing in the world! If they approached you as a potential BB and then you AF'ed them, they woul…
/r/TheRedPill10/11/14 03:53 AM
2

So I am inherently a low value dude. If you say you are low value, everyone else will believe it. Seriously, you need a fuckin' shrink.
/r/TheRedPill10/11/14 03:49 AM
19

Your thoughts are not rational. That makes it hard to not yell at you. Buck the fuck up, dude. You sound like a woman for god's sake! What's the logical, non-emotional, non-depressed way to look at things? 1) You are not repulsive, or else women wouldn't want to even date you. 2) You have your life largely under control, i.e. you are stable, educated and financially secure. 3) You know the truth now, so the BP scales have fallen from your eyes. Mother fucker, you have the tools damn it. It's you…
/r/TheRedPill10/11/14 03:47 AM
1

I did not mean to put words in your mouth. I apologize if that happened. There are those who would deliberately choose the non-physician in that circumstance, because the physician might be masculinized by her achievement, or might have a more jaded attitude (seriously jaded if she's worked in a hospital for long), or she might be tempted to keep her career rather than raise the children as her primary occupation, etc. I am not looking for a mother of my children or housewife, and I enjoy an int…
/r/TheRedPill10/11/14 03:38 AM
18

She is not having trouble getting romantic attention from men. She mentioned both Tinder and OKC. She is having trouble getting romantic attention from men she wants. Specifically, she wants to hook up with her old-money guy employees' school friends, i.e., more old money. And perhaps also with high-level executives or highly successful men at her fundraisers. We all know there is no shortage of customers standing in the "Free Pussy" line. Unless she is literally a diseased troll, there will be …
/r/TheRedPill10/11/14 02:39 AM
7

Step one is having a vision. Step two is having a mentor. Step zero is having some huge, brass swingers, because you are going to be tested, and you are going to fail... but that's where the vision comes in.
/r/TheRedPill10/11/14 02:36 AM
6

The tragedy is that she seems to have no insight as to why.
/r/TheRedPill10/11/14 02:23 AM
10

Yes and no. Her hamster understands it perfectly, but doesn't actually believe it. I mean, her hamster would let her give advice to other women, but never let her apply that advice to herself, because she's someone special, after all.
/r/TheRedPill10/11/14 02:21 AM
13

I disagree. Given two equal women, if one of them is a physician, I'll go for the physician. That's how I think, maybe I'm in the minority. Then again, the one that's the physician is less likely to be willing to be the woman I want her to be due to the fact that she perceives her SMV as higher, so the one that is not a physician (the nurse, PT, dietician, etc) is more likely to act like and be the woman I would actually want. So, if the two choices were exactly identical, I would take the more …
/r/TheRedPill10/11/14 02:19 AM
4

I read it as brag-plaining. Very hamsterish of her.
/r/TheRedPill10/11/14 02:15 AM
2

You refuse to admit that reputation is important to the girls Who. Gives. A. Single. Golden. Fuck. What. Is. Important. To. The. Girls? If they aren't persons of interest, i.e., you're not trying to get with them, then they don't matter. Period. I would maybe fish in friendlier waters to start. If these women are used to being around swimming gods (swimming guys' bodies are well above average) then that's a tough sell already right there. You don't have to be the biggest fish in the world, just …
/r/TheRedPill10/11/14 01:58 AM
8

I think we new guys are over-sensitive to shit tests. We overthink things. If you are just constantly amused and in charge of yourself you will blow through shit tests without even noticing that they occur. The key to shit tests is frame; if you have frame, you have everything. It's fine to be ambiguous with your intent prior to isolating a lady you are interested in, but once you get her alone you need to be very direct about what you want. If she wants it too, she'll stay, otherwise, she'll un…
/r/TheRedPill10/11/14 01:50 AM
1

You are welcome to do as you see fit. I think it's a bad idea.
/r/TheRedPill10/11/14 01:45 AM
1

I've heard it called "tattle-tales" or "tattling". I perceive it as weak and whiny, and even if the person is correct, annoying. The best movie example is in the first Harry Potter movie, when Malfoy turns in Harry, Hermione and Ron for being out of bed at night. Malfoy was correct, but an asshole, so he got punished too.
/r/TheRedPill10/11/14 12:59 AM
5

If a straight male has a female he considers to be somewhat important (#1 plate, gf, wife, etc.), should he be worried if she spends a disproportionate amount of hanging-out time with a gay guy friend? If so, what should he be worried about?
/r/TheRedPill10/11/14 12:46 AM
1

There is a stigma to appealing to authorities. Maybe that's an American thing, maybe that's a "me" thing, but it is definitely a thing.
/r/TheRedPill10/11/14 12:39 AM
3

Don't wait until the end of the conversation to get the number. Get it a bit sooner, then keep using the conversation to build attraction to decrease her chance of flaking. Some guys just get a woman's number and don't call... that feels like rejection to them. If you continue the conversation after you get her number, it makes her feel like you actually will call, and her hamster will then allow her to imagine you actually calling and meeting with her. That's why I don't like "number close"... …
/r/TheRedPill10/11/14 12:37 AM
1

Anger won't solve it. Why get mad at the rain for being wet? Reassign the slacker's work to the non-slackers so everybody has to carry a heavier load, and everybody knows why. Social pressure will take care of the slacker and nobody has to run crying to the mean ol' professor.
/r/TheRedPill10/11/14 12:24 AM
6

My father's advice has never failed anyone who applied it: attach yourself to the revenue stream somehow and they will be too afraid to ever let you go.
/r/TheRedPill10/11/14 12:19 AM
8

In my post-grad work the females were generally as hard-working as the males. Perhaps it is a self-selection situation, as I was in medicine/biology -- I don't know what you were in.
/r/TheRedPill10/11/14 12:14 AM
1

And where are they now? That's what I'm getting at... to be truly successful (and not bankrupt) it takes a lot of brains and skill, or else everyone would do it. I think it is feasible and achievable, but I think people may underestimate what it takes.
/r/TheRedPill09/11/14 01:16 PM
2

It has been my observation (from afar, mind you) that many try while few succeed. Courage and intelligence would be required, but lots of people say that real estate is the shortest path to multi-million dollar payoffs.
/r/TheRedPill09/11/14 05:02 AM
3

You seem to think everyone has the talent and intellect that you claim to have. They do not. Oh, and by-the-by, how useful is that university degree in your self-taught career? University is a time and money sink unless you directly need it for a profession (engineer, doctor, lawyer). Other than that they are useless.
/r/TheRedPill09/11/14 05:00 AM
8

sorry I'm a feminist now? Read carefully: "feminist programming". We are all indoctrinated into the feminist viewpoint whether we want to be or not... it's the way of the West now. You don't have to be a feminist to have been programmed by one.
/r/TheRedPill07/11/14 01:30 AM
2

We call this the "anger phase" around here, in reference to the stages of grief. We don't tend to correct it, because it's not wrong -- it's just something we each tend to grow out of eventually.
/r/TheRedPill07/11/14 01:26 AM
6

Hence, the skittishness to commit.
/r/TheRedPill07/11/14 01:24 AM
-1

perhaps try dating a very young man who wasnt fucked over yet As a jaded and cynical man, I agree, young is the best way to do it. Also, as a low-count female, you should be assured of your own worth, and that will project in your demeanor. Low-count people will also be easier to shock with lewd humor. People who pretend to be shocked tend to do a bad job of it (they always tip their hand, like Fredo in Godfather II).
/r/TheRedPill07/11/14 01:22 AM
14

Seems like a pretty hopeless situation for both parties It is. Hence the cognitive dissonance on both sides. Women realize that the free-wheeling party days of their early college years are unfulfilling, so they decide to hang up their stilettos one fine day and go back to being Ms. Becky Pureheart. She looks for and finds Mr. John Nevagotlaid (they had a class or two together in college). They get all Picket Fence up in that shit, and voila! Marital ennui and lame married-people sex forevah! Bu…
/r/TheRedPill07/11/14 01:14 AM
5

we, as guys, have come across so many sluts and so few loyal girls, we just as soon assume you are all sluts This sounds extremely cynical and jaded, but I can't find myself arguing with it. This modern world is so screwed up, I just can't articulate it...
/r/TheRedPill07/11/14 01:07 AM
4

There has to be a point that you walk away. That should be true of any relationship though, sexual or otherwise. Walking away and finding a better use of your time should always be an option. This is universally true for any and all genders.
/r/TheRedPill07/11/14 01:03 AM
1

It depends on what the guy is looking for. A lot of men here are not in the market for a relationship, hence the lack of sex is interpreted as undesirable. For those who are seeking a relationship, good judgment and self-esteem are more valuable than an uninhibited view of sex, so those traits are valued more highly in the female. Basically, it depends. It depends on the guy (what he's looking for) and the girl (what she is projecting into the world). It's not complex. Different strokes for diff…
/r/TheRedPill07/11/14 12:56 AM
1

If you were, what would you be doing here? You're actually either stupid or a troll... same thing, I guess.
/r/TheRedPill04/11/14 11:56 PM
6

I used to want kids, but I am older now.
/r/TheRedPill04/11/14 03:24 AM
1

Yes, that does seem to contradict. The only salient factor of whether or not I am comfortable is if I am interested in the girl I am directly speaking to... other than that no amount of awkwardness has the power to affect me. Even stark naked (another good story!) I seem to be able to have a good time and make others comfortable.
/r/TheRedPill04/11/14 03:14 AM
1

That is the way that it should be, but that is not the way that it is. If you think you are not competing for your LTR, then you are preparing to lose (unless you are a natural alpha).
/r/TheRedPill04/11/14 03:11 AM
2

Weird username, BTW. Anyways, no, knowing it will not help you. The problem is that you give a shit. You are LTRing this girl in your mind, you caught a bad case of the The Feelings, and you are treading on thin ice. You have too much invested because you are listening to your hamster. Let it go. If the number is bigger than "1" then you will not be happy with what you hear, and if the number she gives is "1" then you will not believe her. It's truly a no-win.
/r/askTRP03/11/14 04:12 AM
4

She's as confused as shit because you are too. Either make a move or next her... I think she wants you to make a move. Expect LMR, though. If she throws some up, make sure to stop things and walk away right away -- make a sandwich or something. She'll let you know if she wants to give it another go, and if she does, then she won't LMR twice. You are so new at this that you don't know what you are doing, and she doesn't know what you are doing either. That's why she's acting this way. If you are …
/r/askTRP03/11/14 04:09 AM
2

Taller men die younger. (It has to do with the strain of pumping a higher water column to perfuse their brains.) There's no magic pill -- big guys just have advantages. At 5'11" you've got nothing to be shitty about. If you want to bulk up there are plenty of sites on the Internet to learn how. And if you want to be able to protect yourself then a trained average size guy can whoop a big guy's ass one-on-one, so go get trained in BJJ/MMA. These are problems with solutions. Go get the solutions i…
/r/askTRP03/11/14 04:06 AM
3

If you have this level of insecurity, it's affecting you as a man. If you can't get detached from these thoughts, you have to detach from the girl. Sorry man.
/r/askTRP03/11/14 04:01 AM
1

It's a bad pun if no one gets it... I was referencing catching fish. Aquaman. Ah well.
/r/askTRP03/11/14 03:59 AM
2

I'll answer, at the risk of sounding like I'm sucking my own cock. Here goes. To be systematic about it, let's add some rigor. Assume all men start as average, i.e., 5/10. Physical - I have an above-average body, but American men's bodies are pretty horrible on average. No points. Social - I have a large enough number of friends that I never am lonely and without people to hang out with when I want to. No points. I easily approach and speak to anyone. I have literally zero social apprehension in…
/r/TheRedPill03/11/14 03:51 AM
2

Then I guess you could say I took the.... wait for it.... "bait". <summarily dragged away and thrown into Pun prison>
/r/askTRP03/11/14 03:31 AM
1

Sometimes you are the pawn in a bigger game. I would think about the context. Put yourself in his shoes: would he be emotionally affected if he knew what you did and what you wanted to do? Is that why she wants to do it? Guy friends are harder to replace than women you just want to bone. Be rational and make the best choice.
/r/askTRP03/11/14 03:25 AM
2

Rules are made to be broken. The real text rule is to only use them for logistics, i.e., when and where to meet. Knowing when to break that rule is a matter of experience and judgment, but if you stay in the confines of the rule you will be playing it a lot more safe.
/r/askTRP03/11/14 03:22 AM
3

The stricter the upbringing, the more they are looking forward to the CC. It seems the only ones who avoid it are the few "naturals" and the ones whose mothers scared the bejeezus out of 'em.
/r/askTRP03/11/14 03:21 AM
1

Mixing alpha and beta comes across badly. You seem like you're a mad, whiny loser. In the future, when and if something similar happens, just remember how you lost your dignity this time, and make it your goal to keep your dignity next time. When you knew she didn't want you was the time to cut things off, not as a tactic, not to "punish" her, not to do anything but spare you both this embarrassment. Keep your head up, man. We all fail at times.
/r/askTRP03/11/14 03:19 AM
7

The fucks wrong with you? Damn skippy. I think you need to soft-next her for the sake of your reputation. Never, never, NEVER discuss Red Pill with anyone in a serious manner. You can joke with guys about it (guys who need it) but make sure you have plausible deniability in case they get weird about things. Seriously, you can get smeared real hard by being in this space.
/r/askTRP03/11/14 03:08 AM
3

He doesn't want to raise somebody else's kid, presumably. That's my guess.
/r/askTRP03/11/14 03:06 AM
3

Not a good sign. I don't think that this one's wife material, based on that one fact and no context. Beige Phillip says, "If you feel a tingle in your balls, it's because you're about to get kicked."
/r/askTRP03/11/14 03:05 AM
6

I still want that innocent joy thats stuck in my mind I wanna be a fuckin' Jedi. Seriously, sometimes I point at things and just hope to move them with my mind. I still play that stupid game that we all played as kids where you "open" automatic doors with your Force powers. I probably always will. That's how ingrained those childhood fantasies can be. The difference is that I became a badass mad scientist instead. Jedis aren't real -- at least not in this galaxy, right George Lucas? -- so I'm go…
/r/askTRP03/11/14 03:01 AM
1

Women in Japan don't even have casual sex I find this claim highly dubious. That said, I have never been to Japan, nor do I spend much time reading or studying up on it.
/r/askTRP03/11/14 02:56 AM
1

Nope. Omega. http://thepopularman.com/omega-male-traits-and-characteristics/
/r/askTRP03/11/14 02:56 AM
1

Text game is almost completely wasted on her. So is cutting off contact (tried that for three weeks!). She responds really well to teasing and a lot of physical contact, but I spaced my kino escalations by about an hour per level to give her time to assimilate things. I think her obsession might be anime, which I'm not into. I guess I'll see! It's a bit nerve-wracking, though... I know what to expect from other women, but this one is so different...
/r/askTRP03/11/14 02:48 AM
1

It is difficult to get one person taken off the lease, and impossible without their consent. If they are a listed resident, it's easier, but if they actually put their name on the line it's pretty difficult.
/r/askTRP03/11/14 01:12 AM
1

HER. Talk about her. Be mysterious about yourself. That is the first date a woman really wants. Questions from her about you are IOI's.
/r/askTRP03/11/14 01:04 AM
1

You're going to need extra (passive) dread to keep this relationship.
/r/askTRP03/11/14 01:01 AM
2

You didn't do anything wrong, you were fine. It's all good, she just didn't reply. No big deal, fish in the sea, move along. It felt like fate because you saw her twice, you got a bit interested, etc. etc. From your report you did great, don't doubt yourself, just remember that the really hot ones can be hard to nail down sometimes.
/r/askTRP03/11/14 12:57 AM
1

This is why PUA advocates routines to starters. You already know what to say when you see the girl, and then when you fly into the routine you seem confident. The problem is that you can seem disingenuous as well, which is why having a natural sense of humor works so much better. You are doing the most important thing, though, which is making the approaches. You will learn. Try telling jokes. Women love to laugh. If all you want from the interaction is to make her laugh three or four times -- do…
/r/askTRP03/11/14 12:51 AM
1

Why would you want to be in her world? It's a confusing place from what I can tell.
/r/askTRP03/11/14 12:48 AM
1

She is being shady. You don't want to know all that's going on there, I'd bet. Hard next.
/r/askTRP03/11/14 12:45 AM
1

Yes. If you go through with it you will go through a lot of phases, including loneliness and regret. You will wonder about what you could have done to fix it instead of ending it. It's hard, but if it's the right thing, then you shouldn't be afraid and just do it. If you have kids, or other major considerations, think it through. Most marriages can be saved (which means some can't), but not all of them should be.
/r/askTRP03/11/14 12:36 AM
1

If it's in your genital area, you should discuss it. If it's in your oral area, you can still transmit it to her genitals when providing oral. YOU CAN SHED VIRUS ASYMPTOMATICALLY. That said, a lot of people have HSV-1 on their mouths. If it's on your mouth, I wouldn't say the word "Herpes", I would say the word "cold sores". It freaks people out less, and it is still accurate.
/r/askTRP03/11/14 12:36 AM
5

He meant most people who talk about self-improvement only talk about it. You don't talk about Fight Club. You fight.
/r/askTRP03/11/14 12:31 AM
2

The same as it ever was, 20% of men are boning 80% of women, more or less. Guys have no problem entertaining 4 women each, when each of those women provide their own living. Alpha offspring are not necessarily alpha. Alpha vs. Beta is a relative comparison... only 20% are desirable to females. If that means that Superman is the only one Wonder Woman bangs, while Green Lantern, Flash and Batman jerk off, so be it, no matter how awesome those other guys are. Aquaman would, of course, be crying in …
/r/askTRP03/11/14 12:28 AM
1

They aren't your connections, though. She's not going to help you get their help at this point. If you want to keep her connections then you need to get her connections. I would go 100% minimal energy expenditure on her, though. Try to make those connections work for you though, meeting them in person and making a direct relationship.
/r/askTRP03/11/14 12:25 AM
27

She's bored. Women hate to be bored. Plus, no one is paying attention to her, so she's not being validated, so she's starting to wonder why she's not getting any attention. EXCEPTION: sometimes they are on their phones because they are being bitchy and superior... you'll realize it almost instantly, though, as soon as you say two words to her. This is the exception, though, and not the rule.
/r/TheRedPill03/11/14 12:22 AM
2

It's not made up, you fucking asshat. God damn but you're ignorant. Shit.
/r/askTRP02/11/14 10:16 PM
2

Get involved with anything wine-related. Women love that shit. Also, have a steady source of available guy friends, chicks dig that too. Source: my buddy who has tons of women at his parties.
/r/TheRedPill02/11/14 10:01 PM
39

She will try to break you, way more than she would ever try a stranger. She knows you are an internal beta, or at least were one, so unless your game is level 9000 (see what I did there?) then this is not going to work. Do not girlfriend this chick, ever. Big trouble there.
/r/TheRedPill02/11/14 09:58 PM
2

Sidebar, mofo. Seriously. It might take a week to get through but it will help more than you know.
/r/TheRedPill02/11/14 09:56 PM
33

Incidentally if a woman pulls out her phone at a bar or party she will be very receptive to approach. It's a rule of thumb that has always served me well... I don't even count it as a cold approach at that point.
/r/TheRedPill02/11/14 09:54 PM
0

some askreddit thread was bashing this wonderful place They never fucking learn. I hope more men come here and learn how to escape the trap society has laid for us.
/r/TheRedPill02/11/14 09:50 PM
8

You find your own lessons. If you only eat what you're fed, you'll never be truly independent.
/r/TheRedPill02/11/14 02:17 PM
3

No. Abundance mentality means you can replace her in a minute, and in fact, you may very well be better off without her. Could she pull this shit with Brad Pitt and expect to get away with it? Then she shouldn't think she can get away with it on you either.
/r/TheRedPill02/11/14 02:05 PM
1

noped right the fuck out of her gravity well I like this imagery. Actually, though, sometimes the beta does get the girl, and she mentions it right there in the article. She expects him to be there for her when her current flame crashes and burns like it always does. When women get really destroyed (or really drunk) then the beta can get in her pants. She knows that. TBH most women would love to be attracted to beta guys. They know those guys treat them better, they know they want the friendship…
/r/TheRedPill02/11/14 01:57 PM
0

See, now, that was much better.
/r/TheRedPill02/11/14 01:48 PM
2

Your tone is bitchy. If you had a valid point I lost it in all the snark. That's completely fine; satire is literature and wit and whatnot, but you should really only do it if you're good at it. I only commented in hopes of helping develop your written expression, otherwise I would have just downvoted and moved on.
/r/TheRedPill02/11/14 04:48 AM
17

If it wasn't hard, everyone would do it. And they quite obviously don't. You're in your 30's, yes... but not your 40's, or 50's. Gratitude, man, gratitude. Those years were wasted, yes, but mourning won't bring them back. Take the good that you can from them and move on. If a tornado trashed your house (and RP is that disruptive, as you know) then you wouldn't cry over the splinters; you'd dig through the rubble, pick up what's left and get on with your life. Same thing. Move on. It most certain…
/r/TheRedPill02/11/14 04:44 AM
10

Don't smoke. It's not fucking worth it, I can't tell you how many smoking motherfuckers we see in the hospital...
/r/TheRedPill02/11/14 04:28 AM
3

Never get involved in a domestic violence situation, just call the police. White Knights have been stabbed and shot, sometimes even by the damsel they were trying to save. It's just like a drowning person; you don't save them by trying to swim them out (if you are untrained) -- you save them by throwing them a rope or something that floats. Same thing with a DV -- call the cops and hope for the best.
/r/TheRedPill02/11/14 04:26 AM
4

She's a woman, she can't be expected to be RP or to maintain frame. Women act out of emotion, in the moment. This is absolutely consistent with the rain being wet.
/r/TheRedPill02/11/14 04:25 AM
5

It's consistent with RP understanding of sexual dynamics in that the wife could not compete in the context of her relationship so she and a couple of her friends decided to compete mafia-style. It is an overt representation of what is often done covertly, i.e., socially. Bitches be crazy.
/r/TheRedPill02/11/14 04:24 AM
8

She wants him to improve and become more alpha, so if she "falls on her face" in love with the new guy that her former orbiter is a better fall-back option. It's kind of a reverse Beauty and the Beast but Just the Beast Part: he's already a Prince, so he needs to work on the whole Beast angle. But not cut her off, because she could almost kinda maybe see herself with him sort of.
/r/TheRedPill02/11/14 04:19 AM
17

Actually she is absolutely right. He did act like a bitch by saying bitchy things and pouting off in silence. He should redirect his anger to the gym, and he should realize this is just one piece of pussy. And he should cut that greedy time-whore out of his life completely. Why didn't she give him that excellent advice before? Oh, yeah. She was being selfish. So she is a bitch, but she's right that he's acting like a bitch too.
/r/TheRedPill02/11/14 04:16 AM
2

Yes, but no. It's about the strategy of the sexes. I think if TRP is just about the sex act, men are better served in PUA forums. They don't need the encouragement vis-a-vis career, finances, health, etc. Broke losers get more ass than yards get autumn leaves... that's kinda the point of the cock carousel. Red Pill is knowing the truth about both sexes, both women and men, and knowing that a man is not and cannot be complete just upping his beaver count for the rest of his life. We were meant fo…
/r/TheRedPill02/11/14 03:59 AM
14

It's not appropriate for my wife to be making money by laying her hands on other men's bodies. Unless she's a surgeon. Then it's okay... I'll be laughing my way across the lake behind our house in my speedboat... she can put her hands all the way up in some dude if she's making surgeon money. But bodypainting? No, fuck no. Find something else.
/r/TheRedPill02/11/14 03:52 AM
3

I do not agree. I think red pill is more about living the optimal life, and cubicle slavery is the opposite of optimal. If you want an RP LTR, fine, or RP plates, fine, or even RP celibacy, fine -- it's all dependent on what you decide. It's GYOW, true, but isn't that the epitome of being master of your own fate? MGTOW is actually a form of activism, if you look into it closely, because they seek to minimize their lifestyle as a protest against an illegitimate power structure.
/r/TheRedPill02/11/14 12:49 AM
1

I remember when I quit WoW, and all my WoW memories felt like real memories, like I could actually flash back to grinding rep with that big fucking frost giant faction (I forget their name). It took a few months to replace those memories with real ones, but it happened for me, and it will happen for you too.
/r/TheRedPill02/11/14 12:19 AM
3

I would not recommend altering your brain chemistry in this way. Some people don't come back from those trips. Most people are fine, but some... some are not. It is definitely not harmless.
/r/TheRedPill02/11/14 12:17 AM
2

Discipline is a better friend than motivation. Discipline is a decision. Motivation is an emotion.
/r/TheRedPill02/11/14 12:15 AM
1

You were definitely cringeworthy. Ouch. That was painful to read, and the "for you" things were strange, but you accomplished what you were going for.
/r/TheRedPill02/11/14 12:13 AM
4

Brewpub, please. I prefer craft beer. It wouldn't hurt if she were also a classically trained chef (real food, not some kind of thai-irish fusion sushi shit).
/r/TheRedPill02/11/14 12:11 AM
2

Yes, exactly. Women only desire the top 20% -- fuck the other 80%, or rather, don't fuck the other 80%. The point that it is rare (someone else said 15% or so) makes it that much more attractive. If there were only one criteria they judged by, that would be a pretty good one to reach their 1-in-5 ratio effectively. So it is the very scarcity of that height of men that makes that height of man more valuable. Also, you can't fake height the way you fake other elements of your SMV.
/r/TheRedPill02/11/14 12:09 AM
1

I think it's more, "If he has an income it makes me feel like my lifestyle and my children's future are more secure, and if he makes enough I can even maybe sit on my ass and pretend to work hard taking care of the brats."
/r/TheRedPill02/11/14 12:06 AM
3

But those lifters don't advertise that fact. It's like the old joke: How do you know if someone is a vegan. Oh, don't worry, they will fuckin' tell you.
/r/TheRedPill02/11/14 12:05 AM
9

The poll was sponsored by a clothing company. That clothing company presents an image. DAYUM, what a coincidence, the "IDEAL MAN" matches the image their clothes represent! Whodathunk it, eh? These coincidences are amazing, almost like they're not accidental sometimes or something...
/r/TheRedPill02/11/14 12:02 AM
1

do what you want to do, what makes you happy This is all of red pill in one sentence.
/r/TheRedPill02/11/14 12:01 AM
1

You don't have to finish to potentially impregnate. It works a lot better if you do, of course, but it is still possible to impregnate with pre-ejaculate.
/r/TheRedPill01/11/14 11:53 PM
2

If all of their person-to-person sexual experiences have stripped them of the ability to pair-bond (more partners = more divorce) then it is natural that they would turn inwards for significance. Self-indulgence always leads to narcissism.
/r/TheRedPill01/11/14 11:45 PM
1

Two words: madonna. whore. Essentially, you see women as "black" or "white"... as maddona (mary) or whore. You'll fuck whores, but madonnas are meant to be pedestalized. It's a weird way to think, but not uncommon in history and fiction. http://en.wikipedia.org/wiki/Madonna%E2%80%93whore_complex
/r/TheRedPill01/11/14 09:18 PM
3

You seem a little damaged and weird. Just judging on your last two comments, I'm not going to go digging around, but just sayin'. I'm just some dude on the Internet, though, so fuck me, but that's my impression.
/r/TheRedPill01/11/14 09:13 PM
0

She is an awful human being. Sometimes those of us who have moved along to understand women as they actually are forget that they are actually still, legally and technically, humans. I mean, sure, they are logic impaired, and their hamsters have superhuman hypnotism powers, but at the end of the day, they should be held to the standard of not being shitlord maggot pig-fucking monsters. But sometimes they are. (Sometimes they aren't, which always makes me happy to discover. So far in my family on…
/r/TheRedPill01/11/14 09:10 PM
4

There is an element of subjugation in it. That's why you do it standing up with her on her knees (that's how I do it, anyways.) You dominate her, make her look up to you. Women know that. They know the unspoken symbolism. That's why they'll line up to choke themselves to tears for that fat Alpha dong, but they draw the line at handy-J's for the Betas they settle for. A friend of a friend once said to her friend, in my presence, "We're pretty girls. We don't have to do that anymore. Oh, sure, I'l…
/r/TheRedPill01/11/14 09:04 PM
5

They're just selfish and stupid Yes, they are. The sad thing is, if she had "confessed" it to him, as a BB/WK he would have "forgiven" her, and that would be that. If someone sent him the link, and he showed it to her, she could have flipped it on him that he was the bad guy for reminding her. She was borrowing a prestige ("virginity") to which she was not entitled. Depending on religion and region, if she were back in India there is a strong possibility she would have been murdered for this typ…
/r/TheRedPill01/11/14 08:59 PM
2

"If you try to divorce rape me I'll show everyone the video of you being a disgusting whore" == blackmail It's all in how you say it, you're right. List the copy of the video as a "marital asset" and put it's value at $25K or so.
/r/TheRedPill01/11/14 08:55 PM
1

This belongs in askTRP. You could get better advice over there.
/r/TheRedPill01/11/14 01:38 PM
2

The rules exist to keep one out of trouble. If it's playful and light, the 2/3 rule can be set aside. The only rule that ever really matters to a woman is "Don't be boring." If he is making her laugh, that's good enough for her, number of texts notwithstanding.
/r/TheRedPill01/11/14 01:27 PM
1

I'm betting a bitch. I know a lot of PhDs.
/r/TheRedPill01/11/14 01:07 PM
2

Use the shift-6 without a space. mc ^ 2
/r/TheRedPill31/10/14 01:54 AM
2

I've read on here before: discipline is a better friend than motivation. (Discipline is a decision, motivation is an emotion.)
/r/TheRedPill31/10/14 01:53 AM
5

Yeah, if you attract her with RP/PUA, it's going to take RP/PUA to keep her. I've learned and forgotten this lesson a few times. Until it is who I really am, the facade will occasionally drop, which is why one has to actually swallow TRP and not just play a role.
/r/TheRedPill31/10/14 01:52 AM
4

Your own article says that unrelated wolves do act in an aggressive/domination pattern. I don't know which bars you go to, but I'm unrelated to every single person in there, especially the "bitches". I don't give two flecks of spittle for what you want to argue, this or that or the other, who the fuck cares. Those are the terms we use, and if you want to change that, then post a Meta and move the fuck on.
/r/TheRedPill31/10/14 01:33 AM
3

I read the exchange, did you see her flirt with that guy? "You seem charming." She is either 1) flirty on the web or 2) really fuckin' hard up.
/r/TheRedPill31/10/14 12:56 AM
0

I broke it down even further: If you don't want to use your emotional mind, use your logical one.
/r/TheRedPill30/10/14 12:34 AM
1

It's "E=mc2". Energy = mass * ( speed of light ) squared I got your point, though. http://imagine.gsfc.nasa.gov/docs/ask_astro/answers/970326a4.html
/r/TheRedPill30/10/14 12:29 AM
12

But I'm doing something about it.
/r/TheRedPill30/10/14 12:27 AM
14

She doesn't, I'd wager. She just said it because she's being defensive, and then her hamster reminds her about that one time at that one bar where she had to pay for one drink, and then she realizes she's not lying. Hamster magic just transmogrified one paid-for drink into endless self-righteousness about money, hooray!
/r/TheRedPill28/10/14 10:18 PM
2

My source is lighten the fuck up. http://www.youtube.com/watch?v=Fcja4WFFzDw
/r/TheRedPill28/10/14 01:00 AM
5

Gay doesn't mean boys fucking boys, it means "lame". Words evolve.
/r/TheRedPill27/10/14 11:41 PM
7

Of note: a hard science PhD doesn't interest women much at all. I think a successful doctor or lawyer gets as much as a two-point bump over a PhD, all other things being equal. I think dentists get a smaller bump than doctors, and that podiatrists/chiropractors don't get much of a bump at all, but that's just conjecture on my part.
/r/TheRedPill27/10/14 08:48 PM
1

FRA = ???? restraining order?
/r/TheRedPill27/10/14 08:29 PM
0

It's always the doubt that fucks with you. Finding out about the cheating is a relief once you know the truth with certainty. I laughed too, in my situation, and couldn't stop smiling for two days.
/r/TheRedPill27/10/14 08:26 PM
4

Often the rebound guy is a beta no-sex emotional tampon, whom she needs just for the emotional support, like a male girlfriend. When my ex-wife moved on, this was the exact guy she chose.
/r/TheRedPill27/10/14 02:43 AM
-2

No offense intended, but this smells of hamster. You project judgments upon others and seem to post-hoc rationalize what was not really a choice. Good try, and thank you for attempting insight, but you are going to have to try harder to do better if you seek to engage as an equal in a male space.
/r/TheRedPill27/10/14 02:39 AM
2

But how do you save said society? We cannot. What, then? Look out for yourself and those you love, while the house burns around everyone's ears.
/r/TheRedPill27/10/14 02:36 AM
2

I disagree as a matter of degree, not principle. Allow me to explain. Appearance is far less important to women than it is to men. Women's fertility is visible, or at least correlated signs are visible. A male's fitness is more intuitive than a "hot-or-not" score. The divergent strategy so neatly encompassed by our AFBB acronym is this: a woman actually needs two (or more) men, but would be absolutely best served by one man fulfilling both roles. The ultimate female fantasy is capturing an alpha…
/r/TheRedPill27/10/14 02:30 AM
3

They are Powertalking. They are on defense against slut-shaming (an effective strategy where females control one another's hypergamy) by pre-emptively stating that their intention was to "land a man". This ensnares the other women's solipsism into identifying with the spurned woman's disappointment (who hasn't had regrets about the one that got away?), rather than perceiving the spurned girl as a loose sexual cannon that could start banging inappropriate men. Never listen to their words. Only th…
/r/TheRedPill27/10/14 02:19 AM
2

I saw that too, and I'd wager it is a woman who has wanted him for some time, or hated the cheating girl all along. It's the kind of thing a woman would say in that circumstance, like Powertalk addressed to him but intended for the cheater-girl. Wimmenz is eeeeevil, doncha know?
/r/TheRedPill27/10/14 01:01 AM
12

It was her roommate -- she's been getting it all along. Crappy facial hair? Check. Guitar in the corner? Check. Loser sleeping on a futon? Triple check. Mated. It never ceases to amaze me.
/r/TheRedPill27/10/14 12:59 AM
11

If I were a lawyer and had to pick a side, I'd pick his. Before Fifty Shades? Maybe not. But now? Yes, definitely, he's going to get a payout. They knew he would when they fired him, and him releasing this info is his tactic to get even more. He's painting his ex as a crazy bitch, and every woman can sympathize with their secrets being spilled by a backstabbing cunt who betrayed them. He's going to have a tough time getting back on the air (XM-Sirius?) but he's going to get a nice check first.
/r/TheRedPill27/10/14 12:53 AM
-1

I'm not qualified to diagnose 'mild' anxiety. A psychiatrist is. The clinical threshold is "impairment".
/r/TheRedPill26/10/14 11:59 PM
1

You only need to change who you are if you are BP. If one were happy as a beta/BP but did not need to be attractive to females, then by all means, remain BP. But, if one wants to succeed in life and with women, yes, you must change yourself to suit the world you actually live in and not Disney fantasies.
/r/TheRedPill26/10/14 09:04 PM
2

think of him as just another insecure bimbo True narcissists are always insecure. You don't want to egg him on, though; there's no telling what he might do.
/r/TheRedPill26/10/14 09:01 PM
-1

There is a pill for your anxiety, propranolol. It blocks fight-or-flight, and it is pretty safe with a low side-effect profile. You could ask your psychiatrist what he/she thinks and if they'd give you a script for as-needed. Anxiety disorders and ADHD can go hand-in-hand. Propranolol is non-addictive and not abused recreationally, so their threshhold for prescribing it is pretty low. I'm not a psychiatrist, though, so talk to them before you start mucking around with it.
/r/TheRedPill26/10/14 08:58 PM
1

My word was "compassion". If you know you won't be changing your mind, but she doesn't realize it, then it is the decent thing to either convince her you mean it or let her go. TRP is amoral, so it's not right or wrong, but I think it's worth considering.
/r/TheRedPill26/10/14 03:26 PM
1

I second this. Bust free however you have to. It's not her winning... you still being fucked up about her is her winning. You need to 1) hard next (aka never see her face again) and 2) bust the slump. If it wasn't a great relationship and ended badly, you just need to get yourself clear of the wreckage, no matter what it takes. (That applies to anyone, man or woman.)
/r/TheRedPill25/10/14 02:29 PM
2

TLDR; Transgendered female confused, frightened, even shocked by apparent dissonance and enmity apparent in the heterosexual dating world. Is this what you said? Because attempting to read what you said made me think that you were talking about yourself the whole time, and how ewwwww you're scared of the scary man-woman-man-haters in this horrible, horrible place. You can't skip in here, read a post or two, and then know what the hell is going on. Especially because you haven't lived it. I mean,…
/r/TheRedPill25/10/14 02:16 PM
10

If you believe religion, then that is the end state. If you don't, then you know what the Teacher meant in Ecclesiastes 1:2 -- "Vanity, vanity, all is vanity." The existentialist school says that we are all Sisyphis, vainly pushing the boulder to the top of the hill, only to see it roll down again. If this world is all there is, the only reason NOT to put a gun in your mouth and pull the trigger is stubborness. The ennui you are experiencing is the curse of the successful man. You have won; now …
/r/TheRedPill25/10/14 02:06 PM
9

If discipline comes from a place of actually giving a shit, and not from a place of control-for-control's-sake, then those you lead will know it and love you for it. -- That's my read of what you're saying here.
/r/TheRedPill25/10/14 01:55 PM
15

She has seen the shadow of the wall. That pancake makeup is getting thicker every year... she better settle down soon, she's no doubt thinking. She's not trying to talk her sisters into settling down, she's trying to talk herself into it.
/r/TheRedPill25/10/14 01:46 PM
1

Males experience a sensation called "tumescence", essentially, a pre-chub. I do not know what women experience, but my understanding is that it is a real sensation and not only metaphorical.
/r/TheRedPill25/10/14 01:43 PM
-1

Out of compassion, you should consider setting her free to find someone else. If you know that she wants the picket fence and you don't then that would be the decent thing to do.
/r/TheRedPill25/10/14 01:26 PM
1

I'm balking at the word "obey". No one should have to "obey" anyone -- it implies a Natural Authority similar to a Supreme Being, or in the modern world, a State. She should be made to understand that 1) he's serious and 2) the consequence of her choice. He is not commanding her obedience; he is simply saying that if she does X, then he will do Y, and if she doesn't want Y then don't do X. That's not control, that's standing up for yourself in the context of a relationship, which all people shou…
/r/TheRedPill25/10/14 01:13 PM
1

He doesn't owe her friendship, and she doesn't owe him sex. He got self-respect out of the transaction, and she got to "vent". Everyone won. Sort of.
/r/TheRedPill25/10/14 01:05 PM
7

In that specific case, the female doesn't usually suggest it unless she has already contemplated or consummated. So in my opinion the outfit and opening the relationship are too different to compare.
/r/TheRedPill24/10/14 11:00 PM
23

I wouldn't call this mate guarding. This is holding her to a high standard. If she's at the bar or a party and you hover over her, not having fun yourself, that's mate guarding. If you tell her that you will be disappointed in her and thereby revoke your commitment if she broaches your previously expressed expectations, that is holding frame. My rule of thumb is: if she sounds like a fucking teenager ("OMG my dad won't let me wear this! Everybody is wearing this stuff.") then she's in the fuckin…
/r/TheRedPill24/10/14 10:57 PM
3

Really? You didn't know? We call it "Whore-a-ween" around these parts. Not that I'm complaining... there are three large universities in my city...
/r/TheRedPill24/10/14 10:55 PM
8

They sometimes seem to repeat themselves because they are using Powertalk. http://www.ribbonfarm.com/2009/11/11/the-gervais-principle-ii-posturetalk-powertalk-babytalk-and-gametalk/
/r/TheRedPill24/10/14 10:44 PM
2

I think that the kids have to be a priority. My wife and I only had cats. ;)
/r/TheRedPill23/10/14 10:07 PM
5

Based on your reply, I believe you are in danger of being her orbiter. I would not be friends with her, if I were you. You are still attracted to her.
/r/TheRedPill23/10/14 05:17 PM
2

I'm sure you know already that TRP doesn't necessarily fix marriages, but it can also end them. Mine was bad and needed to be ended, but remember that not every marriage makes it out alive. That is the price of the truth. The only way to take control of your marriage is to be ready to walk away, and sometimes she will let you. Hell, sometimes she'll pack your bag. That's the price of opened eyes. But most guys around here know that already.
/r/TheRedPill23/10/14 05:07 PM
1

It's one of the last taboos, so it's a ripe source for humor. The humor is meant to be funny, not spiteful, but it's pretty raw sometimes. In the jokes I hear, dick size is mentioned a lot. That, and "Lawd Jeezus there's a faar".
/r/TheRedPill23/10/14 02:42 AM
0

Yes, unfortunately. Other jokes are more subtle, but it's there. I've heard it more and more recently -- white people are tired of the alarmism of race activists. Too much crying wolf, and now real problems get less attention than they should. Jesse Jackson stood on the podium with MLK, but look at his clown ass now. Pathetic.
/r/TheRedPill23/10/14 02:38 AM
16

It has been my experience that ladies might prefer a doctor, dentist, banker etc. as a boyfriend rather than as a one-night arrangement. His profession would provide her with prestige-by-proxy, which is the same temptation we might have by dating a model.
/r/TheRedPill22/10/14 01:45 AM
6

My belief is that women with greater incentive to remain faithful are more likely - but not guaranteed - to remain faithful. My actual experience is with the opposite scenario. When the shame/stigma barrier was removed for my ex-wife when she got knocked up by her lover (how much more embarassed can her family be? is a divorce going to be worse than that?) then she was free to do as she liked. I would surmise that the more barriers in place to manage a partner's baser urges, the better. If all o…
/r/askTRP20/10/14 03:01 AM
6

Saying you will bring back some other chick is not good. What if you were to fail? Then what? It's the same basic idea as ultimatums... not good. My understanding is that the advice here should be the same advice as always: use your mistakes as lessons not yet learned, and maintain frame.
/r/askTRP20/10/14 02:54 AM
1

Yeah, I thought so. I've been thinking about doing monk mode for a bit, learn to be more relaxed. Thanks.
/r/askTRP20/10/14 02:46 AM
7

There is no point in getting angry at someone for being congruent with their nature. May as well be mad at the rain for being wet. Of course she was a dummy for accepting a plane ticket and a hotel room from, and even sharing a bed with, a guy she didn't want to have relations with. It was naive of her and a grown woman should know better, but that doesn't justify his behavior.
/r/askTRP20/10/14 12:26 AM
8

There is a book that will help you immensely. It talks about "covert contracts" that nice guys use to try to get their way via manipulation. You're probably not a bad guy, but acting out like that can make you seem like one. http://www.amazon.com/s/ref=nb_sb_ss_c_0_6?url=search-alias%3Dstripbooks&field-keywords=no%20more%20mr%20nice%20guy&sprefix=no+mor%2Caps%2C177
/r/askTRP20/10/14 12:10 AM
10

I understand the impulse, and empathize, but you were in the wrong and you have since realized it.
/r/askTRP20/10/14 12:07 AM
You can kill a man, but you can't kill an idea.

© TheRedArchive 2026. All rights reserved.
created by /u/dream-hunter